Search results

From 2011.igem.org

Create the page "5" on this wiki!

Page title matches

Page text matches

  • Team:UT-Tokyo/LabNote
    | #5 || [http://partsregistry.org/wiki/index.php?title=Part:BBa_B0014 B0014] || | #3-11-5 || || RBS-RFP-d.Ter || pSB1AK3 || class="number" | 831
    186 KB (30,010 words) - 20:25, 5 October 2011
  • Team:Potsdam Bioware/Labjournal/September part 1
    ** 5 µl DNA (~4000ng) ** 0,5 µl Sfo I
    151 KB (21,501 words) - 17:06, 21 September 2011
  • Team:Potsdam Bioware/Labjournal/August part 2
    * pSB1T3+YFP I clone c: 53.5 ng/µl * 0.5µl EcoRI
    134 KB (19,391 words) - 13:03, 21 September 2011
  • Team:Hong Kong-CUHK/Notebook
    <div style="margin-left:.25in;text-indent:-.25in;"><b><span>5.<span style="font:7.0pt &quot;&quot;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </span ...ly:&quot;新細明體&quot;,&quot;serif&quot;;">‧</span>4H<sub>2</sub>O (5.4425g)</div>
    1.35 MB (148,320 words) - 17:48, 28 October 2011
  • Team:Hong Kong-CUHK/Laboratory/log book
    <div style="margin-left:.25in;text-indent:-.25in;"><b><span>5.<span style="font:7.0pt &quot;&quot;">&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; </span ...ly:&quot;新細明體&quot;,&quot;serif&quot;;">‧</span>4H<sub>2</sub>O (5.4425g)</div>
    1.35 MB (148,301 words) - 15:24, 5 October 2011
  • Team:TU Munich/lab/notebook/part3
    ...<p>PCR:</p><p>amplification with Taq PCR Kit (NEB) according to Florian at 5.7.11. No water control was run due to lacking remaining buffer volume.</p> <dl><dd>5 µl 10x standard buffer</dd></dl>
    121 KB (20,136 words) - 01:54, 22 September 2011
  • Team:Potsdam Bioware/Labjournal/August part 1
    * 5 µl (ca 25 ng) digested geneIII (NgoMIV, AatII) <br /> * 1 µl (ca 5 ng) fusion gene mdnA/geneIII
    117 KB (17,234 words) - 01:03, 22 September 2011
  • Team:OUC-China/Result/date
    <li><a href="/Team:OUC-China/Result/week5">Week 5</a></li> ...c4"><span>E0020e0fp-2</span></p></td><td class="c9"><p class="c4"><span>19.5</span></p></td><td class="c9"><p class="c4"><span>2.19
    146 KB (27,225 words) - 02:34, 29 October 2011
  • Team:Potsdam Bioware/Labjournal/September part 2
    | mdnABCDE without T7-promotor clone 5(III) || 504.0 ** 5 µl Buffer Fermentas Long Enzyme Mix (+MgCl2)
    58 KB (8,180 words) - 00:26, 22 September 2011
  • Team:Hong Kong-CUHK/Laboratory log book
    <li id="5">week 5</li> <strong>5.&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Inoculationtransformation buffer preparation<
    278 KB (35,620 words) - 04:07, 3 October 2011
  • Team:Potsdam Bioware/Labjournal/October
    ...; font-weight: bold;"> Colony PCR of E.coli XL1 blue transformed UP_SG2 (1.5%)</h3> * 5 µl Buffer S with 25 mM MgCl2 (purchased by Genaxxon)
    89 KB (13,149 words) - 18:03, 28 October 2011
  • Team:Johns Hopkins/Notebook/Vio
    {| border="1" cellpadding="5" cellspacing="0" style="margin-left:40px;" | 5
    78 KB (11,015 words) - 22:10, 28 October 2011
  • Team:Potsdam Bioware/Labjournal/June
    * Geneious Pro 5.1.7 * Geneious Pro 5.1.7
    70 KB (9,678 words) - 01:31, 22 September 2011
  • Team:NTNU Trondheim/Journal
    Lab equipment was prepared: Pipette tips, 1.5 ml tubes, toothpicks, SOC, LA with 100 µg/ml ampicillin/ 100 µg/ml specti .... ''E. coli'' with RFP were grown in 3 ml LB with 0, 0.1, 0.3, 0.6, 1.0, 1.5 and 100 µg/ml Tc.
    64 KB (10,273 words) - 15:51, 21 September 2011
  • Team:Michigan/Notebook
    ==Week 1 (5/8/2011-5/14/2011)== '''5/13/2011'''
    73 KB (11,794 words) - 05:23, 29 September 2011
  • Team:MIT/Notebook/
    <li id="w5">Week 5</li> <td class='confluenceTd'> 5, AMP, KH <br class="atl-forced-newline" /> </td>
    131 KB (18,449 words) - 03:35, 29 October 2011
  • Team:Bielefeld-Germany/Backup-Protocols
    * Add 0.5-5 µL plasmid to 50 µl electrocompetent cells * Electroporate at U = 2.5 kV, C = 25 µF, R = 400 Ώ
    62 KB (8,860 words) - 12:04, 15 September 2011
  • Team:Debrecen Hungary/Protocols
    5) Shake the bottle carefully *Crushed ice, 1,5 ml Eppendorf tubes
    51 KB (7,937 words) - 05:49, 22 September 2011
  • Team:Copenhagen/Protocol
    10 μl of 5× reaction buffer 3. Shake at 37°C for 1.5-3hrs until OD600 = 0.4-0.8
    20 KB (3,204 words) - 12:16, 26 August 2011
  • Team:TU Munich/lab/notebook/part4
    ...plated onto LB-Amp plates. The remaining 900 µl were spun down (4000 rpm, 5 min), resuspended in 400 µl and 100 µl of this concentrated bacteria cult 1d, c = 59.5 ng/µl
    78 KB (13,436 words) - 22:42, 28 October 2011
  • Team:DTU-Denmark-2/Team/Protocols
    ...:DTU-Denmark-2/Team/Protocols#Restriction enzyme analysis" class="h2"><b>2.5</b> Restriction enzyme analysis</a><br> .../Team:DTU-Denmark-2/Team/Protocols#Extraction of proteins" class="h2"><b>3.5</b> Extraction of proteins</a><br>
    51 KB (7,868 words) - 09:05, 4 October 2011
  • Team:Potsdam Bioware/Labjournal/July
    * m<small>Agarose</small> = 0.5 g in 50 ml 1x TAE * 5 µl PCR product and 6x loading dye
    55 KB (8,148 words) - 21:15, 18 September 2011
  • Team:Penn/project/protocols/
    • 10 mL pipettes (5)<br /> • 5 mL pipette<br />
    86 KB (13,981 words) - 04:46, 29 September 2011
  • Team:METU-Ankara
    document.getElementById('cm').innerHTML = cm.toFixed(5); document.getElementById('ls').innerHTML = ls.toFixed(5);
    134 KB (20,188 words) - 13:08, 11 October 2011
  • Team:METU Turkey SoftLab
    document.getElementById('cm').innerHTML = cm.toFixed(5); document.getElementById('ls').innerHTML = ls.toFixed(5);
    134 KB (20,159 words) - 17:29, 13 October 2011
  • Team:TU Munich/lab/notebook/part1
    ...rea Mueckl.</p><p>Afterwards cells were incubated in 1 ml SOC medium for 1.5 h at 37 °C, 200 rpm and subsequently plated on LB-agar plates containing a ...o-drop:</p><p>- iGEM I712074 (T7): 62 ng/µl</p><p>- iGEM K098010 (R4): 82,5 ng/µl </p><p>- iGEM K228001 (tRNA): 98 ng/µl</p><p>- iGEM I732017 (R2): 9
    49 KB (7,813 words) - 02:39, 22 September 2011
  • Team:NCTU Formosa/calendar
    ...034+vioC+T) 4. ligation the other failed parts for change backbone to 1C3 5. extract plasmid of D circuit and check by electrophoresis 6. incubated (B0
    46 KB (7,856 words) - 13:40, 5 October 2011
  • Team:METU-Ankara/slider.js
    ...H(9(){$(g).e(\'y\',\'s%\');6(i==3.h-1){$(g).C({z:\'1.0\'},(3.o*2),\'\',9(){5.16(\'7:X\')})}k{$(g).C({z:\'1.0\'},(3.o*2))}i++})}}};$.1k.1o.21={j:\'1l\',h
    7 KB (1,589 words) - 09:52, 20 September 2011
  • Team:UNITS Trieste/jquery.qtip-1.0.0-rc3.min.js
    ...030`!P4404040`!7'f3f3f`'W!` ;)50505` 5/`!Q5dark`!d!red`!CACE6F6F`#7528279`!5'9C2F2` J!`%-*79992` 6.`!O5red`!b!g`4^!`!E@A9DB66`!Q4b9db8c`!6'58792`'N!` ;)
    22 KB (3,202 words) - 14:47, 11 June 2011
  • Team:UNAM-Genomics Mexico/Notebook/pBBR1MCS-5
    ...ing the most efficient way to introduce genes into R. eltli. The pBBR1MCS-5 has a multiple cloning site (MCS) with the following restriction sites: ...espectively, thereafter we'll can insert this amplification in our pBBRMCS-5.
    8 KB (1,339 words) - 21:35, 28 September 2011
  • Team:SYSU-China/temp/menu.js
    ...(x,t,b,c,d){e(t<d/2)6 h.j.A(x,t*2,0,c,d)*.5+b;6 h.j.w(x,t*2-d,0,c,d)*.5+c*.5+b}});',62,74,'||||||return||Math|function|||||if|var|PI|jQuery|pow|easing|7 ... 0.1.m(x,t,b,c,d)},o:3(x,t,b,c,d){2 0.1.e(x,t,b,c,d)},6:3(x,t,b,c,d){2 0.1.5(x,t,b,c,d)},4:3(x,t,b,c,d){2 0.1.a(x,t,b,c,d)},9:3(x,t,b,c,d){2 0.1.8(x,t,b
    18 KB (3,260 words) - 07:03, 5 October 2011
  • Team:BYU Provo/Team Thermosensor/Week24
    ...der, '''8-21A,''' 8-21B, 8-21C, '''8-21D,''' 8-21E, '''5-13A,''' 5-13B, '''5-13C,''' 6-3A, 6-3B, '''6-3C,''' 6-3D, 6-3E ... 6-3G, '''6-3H,''' 4-13A, 4-13B, 4-13C, 4-13D, 4-13E, 4-13F, 4-13G, 4-13H, 5-1B
    2 KB (338 words) - 02:34, 29 September 2011
  • Team:Rutgers/LB1
    ...><h1><span class="shadow"><img src="https://static.igem.org/mediawiki/2011/5/5c/58-bookmark.png" width="10" height="26" /> Laboratory Notebook</span></h <p><strong><u>5/23/11</u></strong> – Mini-Prep Procedure</p>
    62 KB (8,401 words) - 02:39, 29 September 2011
  • Team:Bielefeld-Germany/Protocols/Analytics
    ... sample in a Plastibrand Disposable cuvette 1.5 mL semi-micro PS 12.5 x 12.5 x 45 mm by Brand ...is mix (1X Cell Culture Lysis Reagent, 1.25 mg mL<sup>-1</sup> lysozyme, 2.5 mg mL<sup>-1</sup> BSA, add water for desired volume)
    32 KB (4,735 words) - 02:05, 29 October 2011
  • Team:Grinnell/Notebook/Gels/Esp
    ... ligated with <i>rsaA</i> C-terminal that had been digested 20110606; lane 5: PCR product of plasmid containing <i>esp</i>; lanes 6-8: PCR product using ... ligated with <i>rsaA</i> C-terminal that had been digested 20110606; lane 5: PCR product of plasmid containing <i>esp</i>; lanes 6-8: PCR product using
    32 KB (4,737 words) - 21:32, 1 August 2011
  • Team:Grinnell CN/Notebook/Gels/Esp
    ... ligated with <i>rsaA</i> C-terminal that had been digested 20110606; lane 5: PCR product of plasmid containing <i>esp</i>; lanes 6-8: PCR product using ... ligated with <i>rsaA</i> C-terminal that had been digested 20110606; lane 5: PCR product of plasmid containing <i>esp</i>; lanes 6-8: PCR product using
    32 KB (4,738 words) - 04:14, 27 September 2011
  • Team:Imperial College London/Project/Chemotaxis/Results
    ...te signals that control the direction of rotation of the flagellar motors [5]. The signaling currency is in the form of phosphoryl groups (p), made ava ...on and the lower threshold and staturation level were also studied (Figure 5). </p>
    39 KB (5,767 words) - 09:46, 8 September 2011
  • Team:Paris Liliane Bettencourt/Notebook/2011/08/02/
    *Chloramphemicol : 5-10 µg/mL *Kanamycin: 5 µg/mL
    7 KB (1,186 words) - 16:00, 1 September 2011
  • Team:Harvard/Template:NotebookDataAugust2
    1.5 ul of enzyme (20 units/ul)<br /> 0.5 ul of BsaI-HF<br />
    23 KB (3,737 words) - 22:45, 19 September 2011
  • Team:Colombia/Notebook
    * Biobricks 1, 2, 3, 4 and 5 were resuspended * Biobricks 1, 2, 3, 4 and 5 were resuspended.
    10 KB (1,441 words) - 18:10, 27 September 2011
  • Team:Harvard/Template:NotebookDataAugust3
    *MAGE round 4a, time constants of 5.6s (OZ052) and 1.2s and 5.4s (OZ123). There appeared to be a spark for the OZ123 electroporation (Sar ***numbered, from 1-6, 1-3 is colony 1, 4-6 is colony 2. 1,4=TT 2,5=RR, 3,6=ZR
    23 KB (3,770 words) - 22:30, 19 September 2011
  • Team:Imperial College London/Project/Chemotaxis
    <a href="#Assembly">5 Assembly</a><br /> <p><embed src="https://static.igem.org/mediawiki/igem.org/5/54/ICL_Chemotaxis.swf" width="935px" height="500px" /></p>
    44 KB (6,705 words) - 21:17, 14 September 2011
  • Team:WHU-China/calendarjs
    ...eight-(P?P.height():0)-Sa(E):Math.round(E.width()/Math.max(b.aspectRatio,0.5))}function fa(k){F++;n.setHeight(o,k);if(s){s.css("position","relative");s= ...e.setMonth(a[3]-1);b.setMonth(a[3]-1)}if(a[5]){e.setDate(a[5]);b.setDate(a[5])}lb(e,b);a[7]&&e.setHours(a[7]);a[8]&&e.setMinutes(a[8]);a[10]&&e.setSecon
    72 KB (13,661 words) - 13:53, 24 October 2011
  • Team:Edinburgh/Lab Notebook
    Each was purified on 5 uL glass beads and eluted to 10 uL elution buffer. ...igh up. We expect about 4.1 kb (part + plasmid) yet the bands suggest over 5 kb. We'll sequence it anyway.
    69 KB (11,148 words) - 15:33, 3 October 2011
  • Team:BU Wellesley Software/Notebook/KyleNotebook
    <script src="http://cdn.jquerytools.org/1.2.5/full/jquery.tools.min.js?foo"></script> ...mid prep of our original plated transformations of our selected BioBricks (5 promoters and 3 RBS). Our theory is that contamination occurred when we ma
    50 KB (8,331 words) - 22:49, 28 September 2011
  • Team:XMU-China/Project
    ...ier-protein] + S-adenosyl-L-methionine = [acyl-carrier-protein] + S-methyl-5'-thioadenosine + an N-acyl-L-homoserine lactone.[8] ...on of lux pR by mutating its DNA sequence. Three mutants, IR-3, IR-5, IR-3/5, were obtained by site-directed mutagenesis using 3-step PCR method.
    21 KB (3,151 words) - 17:17, 5 October 2011
  • Team:Tokyo-NoKoGen/protocols
    <meta name="GENERATOR" content="Freeway 5 Express 5.6.1"> 5; Pour LB medium (Step 4) in plate and cool down in clean bench.<br>
    17 KB (2,608 words) - 11:19, 5 October 2011
  • Team:WashU/Notebook/June2011
    == June 5 == *KanMX4: 30.5 ng/uL
    26 KB (4,070 words) - 16:08, 25 July 2011
  • Week 2: May 23-27
    <blockquote>5’ <span style="color:#04B404">TATT</span>GAATTCGCGGCCGCTTCTAGATGGCCG<span <blockquote>5’ <span style="color:#04B404">TATT</span>GAATTCGCGGCCGCTTCTAGATGGCCG<span
    12 KB (1,659 words) - 15:50, 6 June 2011
  • Team:SouthBend-Mishawaka-HS-2/Notebook
    ...border=1 bordercolordark="#000000" bordercolorlight="#FFFFFF" cellpadding="5"> <TD vAlign=top align=left width="14%" ><font size="3" face="Verdana">5</font><br><br><br><br></TD>
    17 KB (2,546 words) - 17:16, 24 June 2011
  • Script
    ...:{"d":"136,-142r-33,25r-28,-40r-30,41r-32,-26r31,-34r-42,-15r15,-35r41,19r-5,-45r44,0r-6,46r41,-20r15,35r-44,15","w":148},"^":{"d":"82,-252r52,0r77,143r ...{m:"bezierCurveTo",a:[n+~~l[0],m+~~l[1],n+~~l[2],m+~~l[3],n+=~~l[4],m+=~~l[5]]};break;case"r":g[j]={m:"lineTo",a:[n+=~~l[0],m+=~~l[1]]};break;case"m":g[
    34 KB (6,310 words) - 02:45, 7 September 2011
  • Team:Brown-Stanford/Lab/Notebook/Week8
    **5 ug of transforming DNA, for each 1 mL aliquot of cells ...00 mL. Incubate at 37 until an OD of 0.2. Harvest cells and resuspend in 4.5 mL of SSMP + BSA.
    12 KB (1,868 words) - 18:11, 28 September 2011
  • Team:Hong Kong-CUHK/Laboratory/protocol
    1.5 Ligation 5. Cell growth optimization
    27 KB (4,356 words) - 18:57, 28 October 2011
  • Reporter: Week 2 May 23-27
    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;5’ <span style="color:#04B404">TATT</span>GAATTCGCGGCCGCTTCTAGATGGCCG<span &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;5’ <span style="color:#04B404">TATT</span>GAATTCGCGGCCGCTTCTAGATGGCCG<span
    8 KB (1,184 words) - 17:21, 13 July 2011
  • Team:Macquarie Australia/Project
    ...flower generation, responses to sunlight and position relative to shade [1,5,6,7,8,9]. Phytochrome proteins act as light sensors by absorbing red/far re ...ome controls photosystem synthesis in anoxygenic bacteria. Nature 417, 202-5.<br>
    11 KB (1,681 words) - 09:53, 5 October 2011
  • Team:Harvard/Template:NotebookData
    *5µL 10x Pfx amplification buffer *1.5µL dNTPs
    14 KB (1,886 words) - 14:52, 12 August 2011
  • Team:WashU/Notebook/June
    ===June 5=== *KanMX4: 30.5 ng/uL
    30 KB (4,553 words) - 17:55, 19 July 2011
  • Team:DTU-Denmark/Protocols
    * 2.5 mg/ml Fresh Lysozym * 0.5 M Na2CO3
    15 KB (2,379 words) - 22:29, 21 September 2011
  • Team:UANL Mty-Mexico/Notebook/Protocols
    <li>Inoculate a single colony into 5 mL of LB media without any antibiotics and grow overnight at 37 °C with vi <li>Centrifuge 50 mL of the culture at 8,000 rpm for 5 minutes at 4 °C.</li>
    27 KB (4,012 words) - 17:38, 13 February 2012
  • Team:UANL Mty-Mexico
    padding-top: 5; padding-right: 5;
    22 KB (2,497 words) - 16:35, 13 February 2012
  • Team:Uppsala-Sweden/unicodemenus.js
    //----------DHTML Menu Created using AllWebMenus PRO ver 5.3-#846--------------- var s0=awmCreateMenu(0,0,0,0,1,0,0,0,0,5,5,0,1,3,0,0,1,n,n,100,1,0,10,10,501,-1,1,200,200,0,0,0,"0,0,0",n,n,n,n,n,n,n,
    15 KB (2,315 words) - 23:44, 12 July 2011
  • Team:Harvard/Protocols
    **12.5µL KAPA readymix **final extension: 72C, 1-5 min
    24 KB (4,085 words) - 03:27, 29 October 2011
  • Team:XMU-China/Data
    ...BBa_K658010,BBa_K658011,BBa_K658012) by mutagenesis at positition 3,5and 3/5 of lux pR. ... BBa_658018, BBa_658019)are designed by mutagenesis at positition 3,5and 3/5 of lux pR. A comparison in performance of the devices can be found in the e
    7 KB (1,085 words) - 02:15, 6 October 2011
  • Team:British Columbia/Model1
    ...tant variant K6R-hmg2, which is stabilized against protein degradation '''[5]'''. ...ene which encodes for a synthase to use GPP to form monoterpenes. We chose 5 different synthases that each produces different monoterpenes in different
    22 KB (3,354 words) - 02:42, 28 October 2011
  • Team:UANL Mty-Mexico/Templates/Template2
    padding-top: 5; padding-right: 5;
    27 KB (3,111 words) - 21:17, 10 September 2011
  • Team:Harvard/Template:NotebookDataAugust4
    ... for the electroporation (around 4.8) when a good time constant was around 5.8. We got excellent efficiency in the transformation for Zif268 alone, but *5: 10^-3
    31 KB (5,048 words) - 23:43, 25 October 2011
  • Team:TU-Delft/Project/Modelling
    ...een the inducer (induction of the Mfp-5 expression?) and the amount of Mfp-5 eventually present on the outer membrane, such as for example the influence ...module will lead to a useful output, namely the adhesive properties of Mfp-5 in relation to the inducer. This output is directly the input for the inter
    12 KB (1,828 words) - 21:46, 3 February 2012
  • Team:Johns Hopkins/Notebook/YTExperiments
    ...hns_Hopkins/Notebook/Vio"><img src="https://static.igem.org/mediawiki/2011/5/5a/Ytknoteblack_03.jpg" width="92" height="35" alt=""></a></td> Run at 70V on a 1.5% agarose gel
    29 KB (4,167 words) - 03:47, 29 September 2011
  • Team:NTNU Trondheim/Protocols
    *Wait 5 minutes. *Incubate 5 minutes on ice
    5 KB (831 words) - 13:33, 21 September 2011
  • Team:UANL Mty-Mexico/Templates/Menu-template
    padding-top: 5; padding-right: 5;
    17 KB (1,789 words) - 16:38, 13 February 2012
  • Team:Harvard/Template:NotebookDataJuly3
    80 5.84 2.01 N 5 84_1 15 83_3
    32 KB (5,125 words) - 20:53, 4 August 2011
  • Team:Harvard/Template:NotebookData2
    **70°C for 5 min **70°C for 5 min
    26 KB (3,991 words) - 23:44, 25 October 2011
  • Team:UNIPV-Pavia/Protocols
    <li class="toclevel-2 tocsection-5"><a href="#SOC"><span class="tocnumber">1.4</span> <span class="toctext">SO ...ref="#M9_supplemented_with_glycerol_.28M9gly.29"><span class="tocnumber">1.5</span> <span class="toctext">M9 supplemented with glycerol (M9gly)</span></
    26 KB (4,031 words) - 15:39, 20 September 2011
  • Team:WHU-China/Notebook/Daytoday
    ... type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.5.2/jquery.min.js"></script> <span style="font-weight:bolder">5/1~5/10</span>, vocation
    29 KB (3,834 words) - 14:34, 26 October 2011
  • Team:Bielefeld-Germany/Protocols/Genetics
    * Add 0.5-5 µL plasmid to 50 µl electrocompetent cells * Electroporate at U = 2.5 kV, C = 25 µF, R = 400 Ώ
    23 KB (3,263 words) - 14:03, 13 October 2011
  • Team:TU Munich/model/bluelightdata
    ...v class='bibtexentry'><a id='Yildirim-2004' ></a><span class='bibtexlabel'>5. </span><span class='bibtexinfo'>Yildirim, N and Santillan, M and Horike, D
    48 KB (7,328 words) - 11:37, 28 October 2011
  • Team:Lethbridge/Results
    ...L of these cells were then resuspended in 5 mL SOC media, and induced with 5 mL or 10 mL of 1 M IPTG. Cells were again incubated at 37°C for approximat The cells were spun down at 10000 x g for 5 min, and resuspended in 4% BIO-RAD standard low melting temperature agarose
    33 KB (5,098 words) - 17:06, 12 April 2012
  • Team:Rutgers/Template/Header
    background-image: url('https://static.igem.org/mediawiki/2011/5/59/Arrows-small.png'); <li><a href="#" class="drop">Projects</a><!-- Begin 5 columns Item -->
    16 KB (1,629 words) - 16:04, 4 November 2011
  • Team:Edinburgh/BioSandwich
    ...assembly process relies on the 3' end of every part having homology to the 5' end of another part. These regions of homology determine the order in whic 5. The parts are placed together, and homology-based assembly is carried out.
    9 KB (1,435 words) - 21:30, 21 September 2011
  • Team:ITESM Mexico/Protocols
    :::::'''a.'''From an ON culture (single colony into 5 mL LB in 50 mL falcon 37°C, 250 rpm), inoculate 1 mL into 100 mL LB (0.25 ...lled water) into the well. Pipette up and down a few times and let sit for 5 minutes to make sure the dried DNA is fully resuspended. We recommend that
    24 KB (3,666 words) - 03:16, 29 September 2011
  • Team:Imperial College London/Project/Chemotaxis/Testing
    ...ttractant, which acts as a ligand for Tsr, an endogenous chemoreceptor. <i>5-α Escherichia coli</i> competent cells were also transformed with pRK415 a These are the values of attractant concentration we have used, when 5µl sample was added into the plate:<br><br>
    22 KB (3,158 words) - 12:29, 14 September 2011
  • Team:Uppsala-Sweden/jquery.jqzoom-core.js
    ...1);9 b=-g.1b.y*(q.2h().B-p.M+1);$(5.6).D({\'C\':a+\'I\',\'B\':b+\'I\'})};G 5};$(g).1D("13",k)};$.13={2m:{H:\'20\',15:3a,16:3a,19:10,1a:0,11:"44",24:17,2
    9 KB (2,177 words) - 14:01, 15 September 2011
  • Team:Utah State/Notebook
    4. Let cuvettes sit with ethanol for 5-10 minutes, then wash 4-8 times with ddH2O 5. Place cuvettes on ice
    24 KB (3,974 words) - 21:52, 28 September 2011
  • Team:METU-Ankara/lab
    ...lled water) into the well. Pipette up and down a few times and let sit for 5 minutes to make sure the dried DNA is fully re-suspended.</li> ...t 50 mL prechilled, sterile polypropylene tubes and leave the tubes on ice 5 to 10 min.
    21 KB (3,185 words) - 10:54, 21 September 2011
  • Team:Glasgow/Results:dispersal
    <td>5'-GTGTGTGAATTCGCGGCCGCTTCTAGAGCGACGACGACAAGGCCATGGC-3'</td> <td>5'-GTGTGTGAATTCGCGGCCGCTTCTAGAGGAAGGAGATATACATATGAGC<br>GATAAAATTATTCACC-3'</
    10 KB (1,541 words) - 00:45, 22 September 2011
  • Team:Johns Hopkins/Notebook/BCAssay
    {| border="1" cellpadding="5" cellspacing="0" style="margin-left:40px;" {| border="1" cellpadding="5" cellspacing="0" style="margin-left:40px;"
    8 KB (925 words) - 23:15, 17 October 2011
  • Team:KIT-Kyoto/DIAP2-MALT実験
    <tr><td align=center>Anneling</td><td align=center>51.5°C</td><td align=center>30sec</td></tr> Tm値　56.5°C<br>
    54 KB (7,329 words) - 09:21, 4 October 2011
  • Team:Grinnell/Notebook/Protocols
    ... LB with 2mL overnight culture. Incubate with shaking to early log phase (~5 x 10<sup>8</sup> cells/mL, OD<sub>600</sub> = 0.2-0.4).</li> <li>Pellet cells in a prechilled sterile centrifuge tube by centrifugation at 5-8krpm for 5min at 4&deg;C. Discard supernatant.</li>
    21 KB (3,695 words) - 04:12, 29 September 2011
  • Team:HKU-Hong Kong/Human Practice
    5. Provide a platform for participants to know more about undergraduate scien ...rial, sans-serif;color:#000000;margin- top:5px;padding: 2px;" cellspacing="5";
    18 KB (2,602 words) - 12:30, 5 October 2011
  • Team:KIT-Kyoto/ぷろとこる
    <tr><td align=center>bacto yeast evtract</td><td align=right>5 g</td></tr> ↓前もって冷やしておいた1.5 mlチューブに100 µlのコンピテント細胞を分注する<BR>
    22 KB (2,442 words) - 08:32, 4 October 2011
  • Team:TU Munich/model/combineddata
    ... ></a><img style='width:100%;' src='https://static.igem.org/mediawiki/2011/5/51/1_Users_schaluck_Desktop_cbdeactive.png' alt='image: 1_Users_schaluck_De
    100 KB (14,899 words) - 11:42, 28 October 2011
  • Team:Grinnell CN/Notebook/Protocols
    ... LB with 2mL overnight culture. Incubate with shaking to early log phase (~5 x 10<sup>8</sup> cells/mL, OD<sub>600</sub> = 0.2-0.4).</li> <li>Pellet cells in a prechilled sterile centrifuge tube by centrifugation at 5-8krpm for 5min at 4&deg;C. Discard supernatant.</li>
    19 KB (3,336 words) - 04:14, 27 September 2011
  • Team:Penn/notebook/
    <h1>5/21/11</h1> ...Gaussia P6 and transferred into 5 bullets 500uL each (labeled on bullet= 2/5 p100 plate)</li>
    70 KB (11,208 words) - 04:45, 29 September 2011
  • Team:Freiburg/Notebook/31 August
    ...op:0in;padding-bottom:0in;padding-left:0.075in;padding-right:0.075in;"| 32,5µl ...top:0in;padding-bottom:0in;padding-left:0.075in;padding-right:0.075in;"| 2.5µl
    53 KB (6,142 words) - 01:14, 22 September 2011
  • Team:ETH Zurich/Biology/Cloning
    * 5 µl buffer 4 * 0.5 µl BSA
    10 KB (1,528 words) - 20:59, 28 October 2011
  • Tianjin/script 1
    ...e[2],e[1],e[3]);case 6:return new c.matrix.M3x3(e[0],e[2],e[4],e[1],e[3],e[5],0,0,1)}},reflect:function(){return new c.matrix.M2x2(-1,0,0,-1)},reflectX:
    20 KB (3,874 words) - 02:46, 7 September 2011
  • Team:HokkaidoU Japan/WetLab
    |0.5 mL ...cells at 20C (for 24 hrs over) at 180-200 rpm (to ΔOD<sub>550nm</sub> = 0.5~0.6)
    14 KB (2,032 words) - 22:46, 3 October 2011
  • Team:HKU-Hong Kong/Lab Protocol
    ...rial, sans-serif;color:#000000;margin- top:5px;padding: 2px;" cellspacing="5"; ...rial, sans-serif;color:#000000;margin- top:5px;padding: 2px;" cellspacing="5";
    16 KB (2,507 words) - 03:19, 5 October 2011
  • Team:OUC-China/Result/week5
    <li><a href="/Team:OUC-China/Result/week5">Week 5</a></li> ... and inoculated them into LB liquid media. Later we activated 4, 5, 11, 4-5 and culture them. .In the night, we coated the plate mediums. </p>
    5 KB (786 words) - 02:36, 29 October 2011
  • Team:Grinnell/Notebook
    ... <i>esp</i> ligated with <i>rsaA</i> that had been digested 20110606; lane 5: PCR product of plasmid containing <i>esp</i>; lanes 6-8: PCR product using <li>Figure 5: lane 1: ladder; lanes 2,3: PCR product of <i>rsaA</i> using new primers fr
    24 KB (3,886 words) - 03:49, 29 September 2011
  • Team:XMU-China/Wetlab Journal
    ===Week 5-8(1st May—28th May)=== Week 5-7(1st May—21st May)
    9 KB (1,290 words) - 19:38, 5 October 2011
  • Team:TU Munich/lab/notebook/solidmatrix
    <td>0.5&nbsp;%</td><td>0.05</td><td>10</td><td>3 <td>1.5&nbsp;%</td><td>0.15</td><td>10</td><td>3
    23 KB (3,846 words) - 20:16, 28 October 2011
  • Team:XMU-China/Notebook
    ===Week 5-8(1st May—28th May)=== Week 5-7(1st May—21st May)
    9 KB (1,287 words) - 21:01, 3 October 2011
  • Team:UTP-Panama/Week 10
    5. The positive control was diluted 1 / 10 before taking him to the plate. ...ck applied to facilitate the entry of the plasmid to the bacteria, it to 2.5 º C for 60 seconds.
    10 KB (1,542 words) - 04:00, 29 September 2011
  • Team:TU Munich/lab/notebook/part2
    ...igested samples from yesterday was performed (running time approximately 1.5 h).</p> colony picking and growth in 5 ml LB-medium with 5ul Amp (Start 9:45h)
    29 KB (4,765 words) - 23:29, 21 September 2011
  • Team:UNIPV-Pavia/Measurements
    <li class="toclevel-2"><a href="#HSL"><span class="tocnumber">3.5</span> <span class="toctext">Assaying 3OC<sub><small>6</small></sub>-HSL co <font size = "5">Measuring promoters transcriptional strength</font>
    19 KB (3,055 words) - 00:40, 22 September 2011
  • Team:Imperial College London/Project Auxin Testing
    ...e_London/Protocols_Auxin"><img src="https://static.igem.org/mediawiki/2011/5/58/ICL_ProtocolIconDark.png" width="140px" align="right"/></a> ...rding to a paper which works at a concentration range of 0 to 260 µM<sup>[5]</sup>. Modelling of the Auxin Xpress construct informed us that IAA produc
    57 KB (9,190 words) - 03:19, 29 October 2011
  • Team:KIT-Kyoto/matsunami/9月
    ...h="150px" align=center>10 µM Primer F</td><td width="70px" align=right>1.5 µl</td></tr> <tr><td align=center>10 µM Primer R</td><td align=right>1.5 µl</td></tr>
    25 KB (3,285 words) - 09:17, 4 October 2011
  • Team:Tec-Monterrey/projectprotocols
    padding:5; <center><img src="https://static.igem.org/mediawiki/2011/5/59/Protocolos01.png"></center><br>
    30 KB (4,184 words) - 20:53, 20 October 2011
  • Team:Johns Hopkins/Notebook/DNAAssayProtocol
    ... day, subculture O/N into a large volume of LB, diluting '''1:100''' (e.g. 5 ml O/N into 500ml). Make sure to use a large flask, so that the cultures wi ...ours until the OD<sub>600</sub> reaches ~0.4. If OD<sub>600</sub> passes 0.5 start over! (Check OD<sub>600</sub> after 1.5hr; when OD ~0.2, check OD aga
    18 KB (2,755 words) - 23:30, 28 September 2011
  • Team:KIT-Kyoto/DIAP2-MALT実験９月
    ...h="150px" align=center>10 µM Primer F</td><td width="70px" align=right>1.5 µl</td></tr> <tr><td align=center>10 µM Primer R</td><td align=right>1.5 µl</td></tr>
    25 KB (3,288 words) - 09:24, 4 October 2011
  • Team:XMU-China/Labjournal
    ===Week 5-8(1st May—28th May)=== Week 5-7(1st May—21st May)
    10 KB (1,568 words) - 01:43, 6 October 2011
  • Team:SouthBend-Mishawaka-HS/Notebook
    (5)Added 2 ul of the diluted DNA in 50 ul of transformation solution (50mm CaC (6)Incubate on ice for 5 minutes<br>
    7 KB (1,077 words) - 17:09, 24 June 2011
  • Team:Waterloo
    .../h3></div><div id="sponsers" style="width: 90%;margin-left:5%;margin-right:5%;"> ...rans-esterification occurs between the 3'OH and the 5'phosphorous from the 5' end of the intron. Subsequent conformational rearrangements ensure that th
    132 KB (19,352 words) - 19:19, 28 October 2011
  • Team:Columbia-Cooper/Project
    <p>24-mer 5'-AATTCGCGGCCGCTTCTAGAGCCA-3’</p> <p>52-mer 5'-TGGGCGTTATCTCTAACCACGCGGAATCTTCTCGTCGTCTGTAAGGATCCTA-3’</p>
    14 KB (2,133 words) - 23:58, 28 October 2011
  • Team:KIT-Kyoto/yokoigawa
    ↓3M CH<sub>3</sub>COONa(pH 5.27)を1/10量、100% ethanolを3倍量加えて、2～3min静置した<br> <tr><td align="center">10 x H Buffer</td><td align="right">5 µl</td></tr>
    32 KB (2,827 words) - 12:42, 2 October 2011
  • Team:TU Munich/model/redlightdata
    ...d of <math xmlns='http://www.w3.org/1998/Math/MathML'> <mrow> <mrow><mn>0.5</mn><mi>n</mi><mi>M</mi> </mrow> </mrow></math> after expiration of the ex
    48 KB (7,341 words) - 11:33, 28 October 2011
  • Team:USC/Notebook/Week10
    [[Team:USC/Notebook/Week5|Week 5]] [[File:week5.jpg|link=Team:USC/Notebook/Week5|Week 5]]
    8 KB (1,044 words) - 03:58, 29 September 2011
  • Team:Arizona State/Notebook/August
    :* Varying DNA volumes added (1, 2.5, and 5 uL RLTs) == Friday, August 5 ==
    19 KB (2,982 words) - 03:06, 29 September 2011
  • Team:KIT-Kyoto/GFP-MLF実験９月かんたん
    抽出したゲルのうち5 µlを20倍希釈し、濃度測定をした<BR> その際、吸光度は5回の平均値を算出したものを用いた<BR>
    71 KB (8,179 words) - 01:41, 6 October 2011
  • Team:KIT-Kyoto/Notebook/LabNote/DIAP2-MALT9
    ...="150" align="center">10 µM Primer F</td><td width="100" align="right">1.5 µl</td></tr> :<tr><td align="center">10 µM Primer R</td><td align="right">1.5 µl</td></tr>
    20 KB (3,273 words) - 03:25, 6 October 2011
  • Team:KIT-Kyoto/Notebook/LabNoteJ/DIAP2-MALTJ9
    ...="150" align="center">10 µM Primer F</td><td width="100" align="right">1.5 µl</td></tr> :<tr><td align="center">10 µM Primer R</td><td align="right">1.5 µl</td></tr>
    19 KB (2,710 words) - 20:04, 5 October 2011
  • Team:XMU-China/Result
    ... 3/5, N represent for IR-3-GFP (BBa_K658017), IR-5-GFP (BBa_K658018), IR-3/5-GFP (BBa_K658019) and IR-GFP (BBa_K658016) respectively.]] ...62). It might be explained that the mutagenesis at position 3 and position 5 of the sequence of lux pR (R0062) changed the binding strength between prom
    8 KB (1,179 words) - 11:03, 28 October 2011
  • Team:Caltech/Protocols
    5. Incubate at 37˚C for 1 hour.<br/> ... tube, add restriction digested and PCR purified insert to backbone in a 3-5:1 molar ratio, usually 1 ul backbone with 2 ul insert works.<br/>
    8 KB (1,283 words) - 23:00, 28 September 2011
  • Team:Grinnell/Notebook/Gels/DspB
    ...adder; lanes 2-4: WT <i>dspB</i> with P<sub>rsaA</sub> colonies 1-4; lanes 5-7: WT <i>dspB</i> with P<sub>xyl</sub> colonies 1-4; lane 8: standard <i>ds ...sub>xyl</sub> colony 3; lanes 3,4: with BBa_K081005 colonies 3 and 4; lane 5: standard WT <i>dspB</i>; lane 6: ladder.
    11 KB (1,699 words) - 14:10, 5 August 2011
  • Team:St Andrews/diary
    <a href="https://static.igem.org/mediawiki/2011/5/58/Presummerm3.png"> <img class="m1" src="https://static.igem.org/mediawiki/2011/5/58/Presummerm3.png" />
    44 KB (7,166 words) - 03:56, 22 September 2011
  • Brainstorming Notes
    ...ous two bases at the end of the previous open triplet. If you were reading 5' to 3', these would be reversed. replace: $1$2$3\t\t$4$5\t$10\t1\n$4$5$6\t$2$3\t$7$8\t$11\t2\n$7$8$9\t$5$6\t\t$12\t3
    7 KB (1,145 words) - 17:50, 3 August 2011
  • Team:Harvard/Brainstorming
    ...ous two bases at the end of the previous open triplet. If you were reading 5' to 3', these would be reversed. replace: $1$2$3\t\t$4$5\t$10\t1\n$4$5$6\t$2$3\t$7$8\t$11\t2\n$7$8$9\t$5$6\t\t$12\t3
    7 KB (1,147 words) - 17:53, 3 August 2011
  • Team:Valencia/Notebook/August
    ...r="#c0c0c0">31</Font> || &nbsp;1 || &nbsp;2 || &nbsp;3 || &nbsp;4 || &nbsp;5 || | &nbsp;4 || &nbsp;5 || &nbsp;6 || &nbsp;7 || &nbsp;8 || &nbsp;9 || 10 ||
    11 KB (1,565 words) - 17:12, 17 August 2011
  • Team:KULeuven/Protocols
    ...ght culture and grow at 37 &deg;C for 2-3 hours (<i>OD</i><sub>600</sub>=0.5)</li> <li>collect the bacterial cells by centrifugation (6000 rpm, 5 min, 4 &deg;C)</li>
    16 KB (2,769 words) - 17:06, 21 September 2011
  • Team:HokkaidoU Japan/Protocols
    |0.5 mL ...cells at 20C (for 24 hrs over) at 180-200 rpm (to ΔOD<sub>550nm</sub> = 0.5~0.6)
    9 KB (1,356 words) - 13:34, 15 December 2011
  • Team:Lethbridge/Notebook/Lab Work/Justin
    ...d for the next 4 months! Last night I inoculated numerous tubes containing 5 mL of LB media with cells from our glycerol stock in HJ's -80<sup>o</sup>C. <p>Harland inoculated 5 mL cultures containing <i>E. coli</i> hosting various biobricks last night.
    18 KB (2,706 words) - 03:50, 29 September 2011
  • Team:Imperial College London/Project Chemotaxis Modelling
    ...ignals that control the direction of rotation of the flagellar motors<sup>[5]</sup>. The signalling group's currency is in the form of phosphoryl (p), w ...ntration is 10<sup>-8</sup> M, and the saturation concentration is 10<sup>-5</sup> M. (modelling based on spiro et al <sup>[1]</sup>, codes were modifie
    22 KB (3,434 words) - 03:57, 29 October 2011
  • Team:Grenoble/Projet/Modelling/Results
    ...vation of the switch on the plate for a higher aTc concentration of $5x10{-5}$</div> <div class="legend"><strong>Figure 5:</strong> Observation of the red stripe on the plate</div>
    35 KB (4,885 words) - 11:16, 25 October 2011
  • Team:Johns Hopkins/Notebook/YVL
    ...hns_Hopkins/Notebook/Vio"><img src="https://static.igem.org/mediawiki/2011/5/5a/Ytknoteblack_03.jpg" width="92" height="35" alt=""></a></td> =====7/5/11=====
    9 KB (1,001 words) - 23:51, 28 October 2011
  • Team:Grinnell CN/Notebook/Gels/DspB
    ...adder; lanes 2-4: WT <i>dspB</i> with P<sub>rsaA</sub> colonies 1-4; lanes 5-7: WT <i>dspB</i> with P<sub>xyl</sub> colonies 1-4; lane 8: standard <i>ds ...sub>xyl</sub> colony 3; lanes 3,4: with BBa_K081005 colonies 3 and 4; lane 5: standard WT <i>dspB</i>; lane 6: ladder.
    11 KB (1,700 words) - 04:14, 27 September 2011
  • Team:Peking R/Project/RNAToolkit3
    ...: open reading frame (ORF), red arrow: hammerhead ribozyme cleavage site, 5'-ss and 3'-ss: group I self-splicing ribozyme corresponding splicing site. ... class that senses the bacterial second messenger c-di-GMP <a href="#r4">[5]</a>. Here, we regard this ribozyme as a prototype to evolve ligand-regula
    26 KB (3,652 words) - 14:52, 28 October 2011
  • Team:BU Wellesley Software/Notebook/EvelynNotebook
    <script src="http://cdn.jquerytools.org/1.2.5/full/jquery.tools.min.js?foo"></script> 5. RBS: BBa_J61100
    29 KB (4,664 words) - 00:38, 29 September 2011
  • Team:Caltech/Recipes
    * 5 g yeast extract *For 25 mg/ml stock solution (usually, chloramphenicol is used at 12.5 µg/ml or 25 µg/ml, add 250 mg chloramphenicol to 10 ml 100% ethanol
    3 KB (502 words) - 00:00, 29 September 2011
  • Reporter: Week 6 June 20-25
    ===Mutagenesis of XylE, Take 5 Day 5=== ===Mutagenesis of XylE, Take 5 Day 6===
    8 KB (1,358 words) - 17:27, 13 July 2011
  • Team:Arizona State/Notebook/July
    == Tuesday, July 5 == * Nanodrop results: (DADA 48 ng/uL, RARA 68 ng/uL, Seq1Seq1 Dan 73.5 ng/uL, Seq1Seq1 Kit 98 ng/uL)
    23 KB (3,494 words) - 02:54, 29 September 2011
  • Team:Minnesota/Protocols
    **5 g/L NaCl **5 g/L Yeast Extract
    9 KB (1,369 words) - 03:54, 29 September 2011
  • Team:Freiburg/Notebook/3 August
    ...g-top:0in;padding-bottom:0in;padding-left:0.075in;padding-right:0.075in;"| 5 ...g-top:0in;padding-bottom:0in;padding-left:0.075in;padding-right:0.075in;"| 5
    21 KB (2,394 words) - 01:04, 22 September 2011
  • Team:Harvard/Template:NotebookData4
    ...urs after inoculation) divided culture in half (1.5mL) and added either 37.5µL or 3.75µL of 20% arabinose solution (to try two different induction lev ...psu > 0 adds in other letters, each with a small probability ranging from .5% to 2%.
    31 KB (4,866 words) - 16:56, 8 August 2011
  • Team:KIT-Kyoto/Notebook/LabNote/GFPMLF9
    : After extracting DNA,I measured 5µl ,and diluted it for 20 times. ...="150px" align=center>10 µM Primer F</td><td width="100px" align=right>1.5 µl</td></tr>
    37 KB (6,399 words) - 03:45, 6 October 2011
  • Team:WHU-China/Notebook/Protocols
    ... type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.5.2/jquery.min.js"></script> id="图片 9" src="/wiki/images/5/5d/Whu-Proto1.jpg"
    93 KB (13,500 words) - 14:53, 4 October 2011
  • Team:Potsdam Bioware/BioBricks
    | BBa_K627004 || mdnD || 5 ...rified compound yielded a high peak with a retention time of approximately 5 min. Minor peaks could be detected during the following 7 min (Fig. 1).
    59 KB (9,011 words) - 23:32, 28 October 2011
  • Team:TU Munich/lab/notebook/methods
    <li class="toclevel-2 tocsection-5"><a href="#Glycogen.2Fethanol_precipitation"><span class="tocnumber">1.4</s ...><a href="#Transformation_of_purified_ligations"><span class="tocnumber">1.5</span> <span class="toctext">Transformation of purified ligations</span></a
    19 KB (3,094 words) - 01:33, 22 September 2011
  • Team:BYU Provo/Team Thermosensor/Week9
    Set up overnight on colonies from T26-1 lig plate from slices 2 and 5 (like a pizza! Insert drawing of a pizza) * T28-5-1 through T28-5-4
    2 KB (312 words) - 08:14, 24 September 2011
  • Team:Harvard/Project/Design
    ...d position in a backbone. Amino acid positions are specified by -1,1,2,3,4,5, and 6. ...e on opposite DNA strands, and are separated by a spacer that is typically 5-7 bp long.
    26 KB (3,950 words) - 12:55, 28 October 2011
  • Team:Grinnell CN/Notebook
    ... <i>esp</i> ligated with <i>rsaA</i> that had been digested 20110606; lane 5: PCR product of plasmid containing <i>esp</i>; lanes 6-8: PCR product using <li>Figure 5: lane 1: ladder; lanes 2,3: PCR product of <i>rsaA</i> using new primers fr
    24 KB (3,797 words) - 04:14, 27 September 2011
  • Team:KIT-Kyoto/yokoigawa1
    ↓3M CH<sub>3</sub>COONa(pH 5.27)を1/10量、100% ethanolを3倍量加えて、2～3min静置した<br> <tr><td align="center">10 x H Buffer</td><td align="right">5 µl</td></tr>
    15 KB (1,687 words) - 14:54, 2 October 2011
  • Team:BU Wellesley Software/Notebook/CraigNotebook
    <script src="http://cdn.jquerytools.org/1.2.5/full/jquery.tools.min.js?foo"></script> 5. <span style="text-decoration:line-through;">Create key generator for the
    38 KB (6,388 words) - 05:18, 28 September 2011
  • Team:Caltech/Week 3
    Transfer 0.5 mL aliquots of BPA and 5 mL aliquots 17a-ethynylestradiol cultures from June 23 to fresh minimal med <td>230.5</td>
    9 KB (1,375 words) - 23:15, 11 July 2011
  • Team:Freiburg/Notebook/19 July
    ...top:0in;padding-bottom:0in;padding-left:0.075in;padding-right:0.075in;"| 0,5 μl ...top:0in;padding-bottom:0in;padding-left:0.075in;padding-right:0.075in;"| 0,5 μl
    30 KB (3,509 words) - 00:58, 22 September 2011
  • Team:BYU Provo/Protocols
    * 1.5 μl 10 mM dNTP's * 0.5 μl Phusion Polymerase
    11 KB (1,803 words) - 22:50, 28 October 2011
  • Team:Lyon-INSA-ENS/Realisation/Protocols/DNA-purification
    <p style="text-align : center"> <font color="green" size="5"> Plasmid or Cosmid DNA Purification Using QIAGEN HiSpeed Plasmid Midi Kits <p style="text-align : center"> <font color="green" size="5"> Procedure </font> </p>
    7 KB (990 words) - 10:44, 10 January 2012
  • Team:WashU/Notebook/July2011
    **7.5 uL dNTP **1.5 uL Accutaq LA DNA polyermerase
    18 KB (2,731 words) - 04:45, 28 September 2011
  • Team:EPF-Lausanne/Notebook/August2011
    * The 3' final and 5' final primers are not suitable for the stitch step. Concentrations and hea ... for the 4th mutagenesis(about 10 colonies). She made liquid cultures from 5 of them, the miniprep will be done tomorrow.
    39 KB (6,395 words) - 09:04, 21 September 2011
  • Team:Freiburg/Notebook/9 September
    5µl BSA (10x)<br/> 5µl NEB buffer 4<br/>
    32 KB (3,770 words) - 00:24, 22 September 2011
  • Team:EPF-Lausanne/Notebook/September2011
    == Monday, September 5 2011 == ...TetR, LacI is still expressed. In fact, Pconst is weaker than Ptet. The "2.5" data seems strange, I perhaps missed to put IPTG in this well.
    15 KB (2,527 words) - 08:43, 21 September 2011
  • Team:Bielefeld-Germany/Protocols/Materials
    ...the stock is diluted in 1 L dH<sub>2</sub>O for the gel electrophoresis (0.5 x TAE buffer). * 5 g yeast extract
    12 KB (1,740 words) - 17:28, 25 October 2011
  • Team:TU Munich/model/andgatedata
    .../tbody></table></div></div><h2 class='section'><span class='section_label'>5</span> <a id='magicparlabel-48897' ></a>Simulation</h2><div class='standard
    43 KB (6,209 words) - 11:46, 28 October 2011
  • Team:HIT-Harbin/HIT-Harbin main.css
    text-shadow: rgba(255,255,255,.5) 0 1px 0; color: rgba(0,0,0,0.5) !important;
    19 KB (1,871 words) - 10:40, 25 November 2011
  • Team:HIT-Harbin/header/menu
    text-shadow: rgba(255,255,255,.5) 0 1px 0; color: rgba(0,0,0,0.5) !important;
    17 KB (1,729 words) - 20:01, 4 October 2011
  • Team:Grenoble/Projet/Results/Device
    ...5/55/Hysteresis_10-6.png"><img src="https://static.igem.org/mediawiki/2011/5/55/Hysteresis_10-6.png" class="centerwide"/></a> ~ $3x10^{-5} M$.
    23 KB (2,980 words) - 01:52, 29 October 2011
  • Team:Paris Bettencourt/Experiments/Methodologies/Integration
    ...ansferase (cat) selectable in either E.coli or B.subtilis (chloramphenicol 5μg/ml), β-lactamase (bla) selectable in E.coli only (ampicillin 100μg/ml) ...ansferase (cat) selectable in either E.coli or B.subtilis (chloramphenicol 5μg/ml), β-lactamase (bla) selectable in E.coli only (ampicillin 100μg/ml)
    11 KB (1,629 words) - 02:29, 29 October 2011
  • Regions/Regional Jamboree Proposal
    * iGEM 2011 World Jamboree: '''November 5-6, 2011 or Feb 4-5, 2012 *''' ...entation per room. Thus, to fit the presentations for 60 teams in one day, 5 rooms would be required.
    11 KB (1,735 words) - 16:19, 26 January 2011
  • Team:Lethbridge/Notebook/Lab Work/Group1
    * A gel was made following the 1% Agarose Gel Protocol (100mL), but 1.5% with 1.50g of Agarose and 100mL of 1x TAE. *Ran a 1% Agarose Gel using 0.5 TAE buffer solution for parts BBa-J04500 in pSB1AK3, R0040, and Lumazine sy
    22 KB (3,366 words) - 03:32, 29 September 2011
  • Team:Michigan/Human Practices
    ==5/11/11== ==5/24/11==
    7 KB (1,156 words) - 14:39, 27 September 2011
  • Team:WashU/Notebook/July
    **7.5 uL dNTP **1.5 uL Accutaq LA DNA polyermerase
    6 KB (1,065 words) - 17:58, 19 July 2011
  • Team:UNITS Trieste/Parts
    <th>Seq 5' --> 3'</th> ...</td> <td>GTTTCTTCCTGCAGCGGCCGCTACTAGTATCACGCCGCACTCCTCAACG</td> <td>95° 5' | 10x (93° 30" | 56° 30" | 72° 40") | 23x ( (93° 30" | 65° 30" | 72°
    6 KB (752 words) - 10:05, 28 October 2011
  • Team:BU Wellesley Software/Notebook/AlbertoNotebook
    <script src="http://cdn.jquerytools.org/1.2.5/full/jquery.tools.min.js?foo"></script> 5. I13458_I13453_E0240 (uncut)
    51 KB (8,151 words) - 05:01, 29 September 2011
  • Team:BU Wellesley Software/Notebook/VanessaNotebook
    <script src="http://cdn.jquerytools.org/1.2.5/full/jquery.tools.min.js?foo"></script> 4. Bba_E1010 56.5 ng/uL
    25 KB (3,928 words) - 02:07, 28 September 2011
  • Protocols
    *5&#956;l buffer *5&#956;l Purified PCR product
    6 KB (961 words) - 23:36, 30 July 2011
  • Team:Alberta/Methodology/Protocols
    ...2 days, then transfer to a well lit room and let the culture conidiate for 5 days at room temperature. It should produce a layer of bright orange conidi <li>Take 300 g of Potato (Baking Potatoes) and dice into 0.5 cm cubes.</li>
    18 KB (2,545 words) - 00:27, 29 September 2011
  • Team:Sevilla/Week2
    <p>4. Add 250 μl of FAPD2 Buffer and gently invert the tube 5 times to lyse the cells and incubate at room temperature for 2 min.</p> <p>5. Add 350 μl of FAPD3 Buffer and invert the tube 5 times</p>
    13 KB (1,866 words) - 01:46, 22 September 2011
  • Team:Macquarie Australia/Notebook
    * Step 5) To these 15ul aliquots, we add into each: 5. 1 uL of T4 DNA ligase
    27 KB (4,274 words) - 11:05, 4 October 2011
  • Team:Penn State/Lab/LabProtocols
    *5&#956;l buffer *5&#956;l Purified PCR product
    8 KB (1,128 words) - 17:39, 27 September 2011
  • Team:Korea U Seoul/Notebook
    At Massachusetts Institute of Technology 2nd competition: 2011. 11/5~7 =='''5/30 - Research topic selected'''==
    24 KB (3,463 words) - 07:02, 5 October 2011
  • Team:Harvard/Template:NotebookData3
    *Targets 1, 2, and 5 will have equal distributions of backbones: ****6 and 5
    27 KB (3,941 words) - 22:02, 20 September 2011
  • Team:Nevada/Notebook/Weeks912
    ...ef="https://2011.igem.org/Team:Nevada/Notebook/Weeks58"><font size=4>Weeks 5-8</font></a>&nbsp;&nbsp;&nbsp; ...howed that we have an empty topo Vector on all three digests (#'s 2, 3 and 5).
    30 KB (5,035 words) - 03:20, 29 September 2011
  • Team:British Columbia/Protocols/Gcms
    # Make 5 mL overnight cultures of yeasts to be sampled (18-20 hours @ 30 degrees). T # Transfer all of the cultures into falcon tubes and spin down the cells (5 min @ 2500g).
    6 KB (943 words) - 17:48, 18 October 2011
  • Team:Wisconsin-Madison/protocols
    <ol><li> Pellet the overnight culture(s) in a 1.5 ml or 2ml eppendorf tube. (I usually do 10,000 rpm, 3 minutes) 1 minute wo ...II. Invert 4-6 times to mix. Do not allow reaction to lyse for more than 5 min. Sample should clarify.
    27 KB (4,151 words) - 23:09, 28 September 2011
  • Team:UNICAMP-EMSE Brazil/protocols/Mini prep
    ==<font size="5" color=#086A87>Miniprep:== ... 30 seconds at 4°C in a microfuge. Repeat this operation with the other 1,5 mL.
    10 KB (1,513 words) - 16:08, 27 September 2011
  • Team:UTP-Panama/Week 14
    ==Week 14: September 5 to 10== ==September 5==
    3 KB (453 words) - 04:09, 29 September 2011
  • Team:Gaston Day School/Notebook
    ...FFFFFF;background-color:#4169E1;" cellpadding="7" cellspacing="4" border=".5" bordercolor="#fff" width="100%" align="center" |5
    6 KB (646 words) - 23:51, 27 September 2011
  • Team:ULB-Brussels/Results
    ... that the PCR reactions gave 2 fragments of appropriate size (3,699 bp and 5,229 bp for the PFL and IN fragments, respectively). </p> ...e </a>1 PCR amplifications of the PFL and IN fragments. (A) A fragment of 5,229 bp of the pKD46 plasmid was amplified by PCR as described in Materials
    31 KB (4,802 words) - 01:36, 22 September 2011
  • Team:UC Davis/Data LacI
    thispagenumber = 5; <span class='xdata_3d'>0, 1, 2.5, 5</span>
    15 KB (949 words) - 18:48, 22 October 2011
  • Team:Potsdam Bioware/Meetings
    * currently: 5 answers ** Sorbet: 5 (without sorbet)
    74 KB (9,960 words) - 01:06, 22 September 2011
  • Team:Imperial College London/Project Chemotaxis Testing
    ...don/Protocols_Chemotaxis"><img src="https://static.igem.org/mediawiki/2011/5/58/ICL_ProtocolIconDark.png" width="140px" align="right"/></a></h3> ...don/Protocols_Chemotaxis"><img src="https://static.igem.org/mediawiki/2011/5/58/ICL_ProtocolIconDark.png" width="140px" align="right"/></h3></a>
    26 KB (4,242 words) - 03:45, 29 October 2011
  • Team:UNICAMP-EMSE Brazil/Notebook/17 September 2011
    ...sis Gel 1, 17/09/2011.'''</font> <br>Gel 1: pSB1/ pSB 2/ pSB 3/ pSB 4/ pSB 5/ RBS+IL-12 C4/ RBS+IL-12 C5/ RBS+HlyD C4/ RBS+HlyD C5/ RBS+Tol C C10/ RBS+T ...SB1C3 vector purified from the gel (volume of ladder applied 6 uL; sample: 5 uL DNA +1 uL buffer),
    14 KB (2,168 words) - 14:09, 19 September 2011
  • Team:Bielefeld-Germany/Results/NAD
    |rowspan="5"|Expression |5.59
    22 KB (3,374 words) - 00:31, 29 October 2011
  • Team:Johns Hopkins/Notebook/BBProtocol
    {| border="1" cellpadding="5" cellspacing="0" style="margin-left:40px;" | 5
    7 KB (861 words) - 23:32, 28 September 2011
  • Team:KIT-Kyoto/nakagawa9月
    ↓1.5 mlチューブ中のゲルスライスの重さを量った<BR> ↓カラムを新しい1.5 mlチューブに移しかえた<BR>
    28 KB (2,527 words) - 06:13, 3 October 2011
  • Team:Minnesota/dingx055-08302011183812-167
    <nowiki>- 5 uL vent buffer</nowiki> <nowiki>- 5 uL forward primer</nowiki>
    2 KB (331 words) - 22:49, 27 September 2011
  • Team:TU Munich/jquery.inifinitecarousel2.js
    ...w);$(\'#D\'+b).41(I,0,3(){$(w).7({\'H-B\':\'0 -11\',\'F\':\'.5\'})}).u({F:.5},I);d=0;2j();$(\'#14\'+b).V().1s();2l(q);1t(3(){$(\'#D\'+b).18(\'y\',3(){1u
    9 KB (2,208 words) - 17:49, 25 October 2011
  • Team:Fatih Turkey/test6
    <p style="padding-left: 30px;">5)<a href="#5">The Effect Of Feton Reant Solution On The Biofilm</a></p> ...LB broth culture which was incubated for 12 hours at 37°C at 7000 rpm for 5 minutes. It is filtered with 0,2 filter, afterwards.</p>
    45 KB (7,068 words) - 09:44, 28 October 2011
  • Team:Lethbridge/Notebook/Lab Work/Group2
    ==Week 5 May 30 - June 5 2011== ==Week 19 September 5 - 11==
    13 KB (1,994 words) - 02:57, 29 September 2011
  • Team:Paris Liliane Bettencourt/Notebook/2011/07/01/
    </li><li>5 µL of minipreped DNA (Qiagen - attC) + 1 µL of loading buffer 6x <br />condition 2&nbsp;: Using 5 µL of DNA (add 37 µL of water)
    7 KB (1,095 words) - 15:51, 27 August 2011
  • Team:UNIPV-Pavia/Team
    nam[5] = "Daniele Sartori"; port[5] = "https://static.igem.org/mediawiki/2011/0/06/Danielesartori.jpg";
    23 KB (2,804 words) - 13:16, 25 November 2011
  • Team:ETH Zurich/Biology/Validation
    ...was provided by Sven Panke on the plasmid pCK04AxylR according to [[#Ref5|[5]]]. The reporter plasmid was constructed by using [http://partsregistry.org ... the [http://partsregistry.org/Part:BBa_K625002 BBa_K625002] setup (around 5-fold). Thus both of the provided promoters can be used for transcriptional
    27 KB (4,299 words) - 03:17, 29 October 2011
  • Team:Harvard/Test Page 2
    background:url('/wiki/images/5/56/GroningenBarVideos.png'); } background:url('/wiki/images/5/53/GroningenBarBrainstorm.png'); }
    36 KB (4,536 words) - 18:48, 7 July 2011
  • Team:EPF-Lausanne/Protocols/TetR Extension PCR
    ...template; they differ by their primers. The common sequence uses primers ''5' final'' and ''common primer'', whereas the mutant sequences use primers '' ...h the common sequence and one mutant sequences as templates, and primers ''5' final'' and ''3' final''. Each mutant is reacted separately.
    4 KB (602 words) - 08:15, 20 July 2011
  • Team:Freiburg/Notebook/26 July
    # Incubate on ice for 5 minutes # 5 μl NEB4 buffer (stored at iGEM’s, -20°C)
    24 KB (2,938 words) - 01:01, 22 September 2011
  • Team:UNITS Trieste/Data
    <area shape="poly" coords="109,33,45,3,16,7,5,25,2,64,10,123,26,150,57,174,87,186,136,195,171,183,205,177,224,174,239,154 <area shape="poly" coords="250,42,266,16,290,1,317,3,387,33,452,5,475,4,491,18,497,67,489,124,468,154,439,175,397,190,343,197,302,191,272,172
    38 KB (4,518 words) - 15:39, 28 October 2011
  • Team:Cornell/Week 10
    <font size="5"> <i> August 7th - August 13th </i></font> :::5μL 10x NEBuffer 2
    13 KB (1,865 words) - 17:23, 18 September 2011
  • Team:Cornell/Protocol
    :::37.5μL ddH2O :::5.0μL 10x buffer
    17 KB (2,930 words) - 03:58, 29 September 2011
  • Team:Amsterdam/Notebook/Protocols/Digestion
    |align="right"|0,5 |align="right"|5,5
    3 KB (488 words) - 23:59, 21 September 2011
  • Team:Freiburg/Notebook/30 August
    ...order-left:0.0139in solid #808080;border-right:none;padding:0.0194in;"| 32,5µl ...border-left:0.0139in solid #808080;border-right:none;padding:0.0194in;"| 2.5µl
    25 KB (2,824 words) - 01:13, 22 September 2011
  • Team:Harvard/Template:NotebookDataJuly2
    ...ound the 1529620 locus. Not all the cultures grew; 100µL plate cultures 1-5 and 2mL plate cultures 1-12 were used. The first steps of the PCR involved heating at 95* (for 5 minutes) and 98* (for 20 seconds). Annealing temperature was 56*. Extension
    33 KB (5,222 words) - 18:48, 3 August 2011
  • Team:KIT-Kyoto/matsunami
    <tr><td align=center>Anneling</td><td align=center>(Tm-5)°C</td><td align=center>30sec</td></tr> Tm値　56.5゜C<br>
    48 KB (6,897 words) - 04:27, 30 September 2011
  • Team:Queens Canada/Safety/Bioterrorism
    <body onload="runAccordion(5,75)"> ...ulanic acid along with β-lactams can combat β-lactam resistant bacteria [5]. In the same vein, scientists in the antiBT task force should examine the
    22 KB (3,286 words) - 22:31, 28 October 2011
  • Team:Brown-Stanford/Lab/Protocols/Anabaena
    *Mating plates: BG11 or BG11 + 5% LB (~15 ml in 6cm plate) ...'<br>not used<br>??<br>24 hr at 0.1, then 3<br>not used<br>50<br><br>2.5/2.5}}}}
    6 KB (994 words) - 18:18, 28 September 2011
  • Team:UC Davis/lightbox/effects.js
    return (-Math.cos(pos*Math.PI)/2) + .5; return (-Math.cos(pos*Math.PI*(9*pos))/2) + .5;
    38 KB (3,780 words) - 15:44, 26 August 2011
  • Team:UNIPV-Pavia/TestTeam
    nam[5] = "Daniele Sartori"; port[5] = "https://static.igem.org/mediawiki/2011/0/06/Danielesartori.jpg";
    22 KB (2,731 words) - 22:20, 15 September 2011
  • Team:Bielefeld-Germany/Protocols/Downstream-processing
    * Culture volume: 2.5 - 5 L * After cultivation biomass was collected by centrifugation at 5,000 ''g'' at 4 °C for 20 min.
    23 KB (3,137 words) - 01:53, 29 October 2011
  • Team:Edinburgh/Biorefinery Appendices
    |Reactor 5 Working capital, allow 5% of fixed capital to cover the cost of the initial oxalic acid and 2-MTHF c
    10 KB (1,230 words) - 21:58, 10 October 2011
  • Team:HKU-Hong Kong/Lab Diaries
    ...rial, sans-serif;color:#000000;margin- top:5px;padding: 2px;" cellspacing="5"; <LI>PCR was used to obtain HNS(FL) at 5 different temperatures to test which temperature is optimal for annealing.
    8 KB (1,282 words) - 06:59, 5 October 2011
  • Team:Warsaw/SyntheticCloning/SyntheticCloning
    <li>2. Dephosphorylate 5' phosphate - this prevents DNA pieces from self-ligation</li> <li>5. Extract vector and insert from the gel.</li>
    4 KB (654 words) - 01:58, 21 September 2011
  • Team:Kyoto/Lab Work
    ...7,8: DNA ladder(λDNA digested Hindlll,100bp), lane 3,4: glnG1,glnG2, lane 5,6: glnL1,glnL2<br/> JCM5070-1　5.2μg/ml<br/>
    21 KB (2,971 words) - 02:41, 6 October 2011
  • Team:Calgary/Notebook/Protocols/Process22
    ... EDAC in 80% DMSO. (Dissolve 10 mg of EDAC in 0.1 mL of 80% DMSO) Add 12.5 uL of the EDAC to the cyclohexanepentanoic acid solution you made. Don’t <li>Make up a stock solution of 100 mM Biotin by weighing it out into a 1.5 mL Epindorff on an analytical balance (be careful when you do this) spin do
    4 KB (708 words) - 02:21, 29 October 2011
  • Team:Brown-Stanford/Lab/Protocols/NEB 5-alpha
    === NEB 5-alpha High-Efficiency Transformation === For C2987H (5-alpha competent cells), perform steps 1-7 in the tube provided.
    1 KB (214 words) - 18:18, 28 September 2011
  • Team:Tokyo Tech/Projects/Urea-cooler/index.htm
    Fig. 5 The reactions related with the urea cycle Fig. 5 The reactions related with the urea cycle
    31 KB (4,564 words) - 02:57, 29 October 2011
  • Team:Peking S/lab/protocol/mutagenesis
    * A pair of primers which juxtapose their 5' ends and have contrary directions of 3' ends to import the mutation; ddNTP Mixture (2.5 mM for each) &nbsp;&nbsp; 4uL
    3 KB (464 words) - 09:03, 2 October 2011
  • Team:OUC-China/Result/week6
    <li><a href="/Team:OUC-China/Result/week5">Week 5</a></li> ...erify them anddig big one to recyle the 3055 band. We prepared to link the 5&4 from previous experiments and the recylcled K131017.</p>
    7 KB (1,093 words) - 02:37, 29 October 2011
  • Team:VIT Vellore/Documentation
    <li>LB broth bacteria culture medium. The content are 1% Tryptone, 0.5% yeast extract, 200 mM NaCl, then it sterilize by autoclaving in suitable a <li>STET mix which is contain 5% (v/v) Triton X-I 00, 50 mM Tris-HCl, pH 8.0, 50 mM EDTA, pH 8.0, 8% (w/v)
    8 KB (1,307 words) - 22:11, 5 October 2011
  • Team:Harvard/Project/Test
    ...ZFB promoter is constitutively on, the cells will express URA3, break down 5-FOA, and die. ...A3 will be expressed, and the cell will convert 5-FOA to the toxic product 5-fluorouracil, causing cell death. An alternate method of selecting against
    15 KB (2,404 words) - 00:54, 29 October 2011
  • Team:Fatih Turkey/sporicideprocedure
    ... SG-Schaeffer sporulation medium (stock solution) : 16 g LB broth/liter, 0,5 g MgSO4 . 7H2O, 2 g KCl/lt.</p> <p>5. The caps are loosened and autoclaved in a pan of water for 20 min. on slow
    20 KB (2,633 words) - 19:52, 28 October 2011
  • Team:UTP-Panama/After Regional Week 1
    |eppendorf tubes of 0,5 mL <br>- we will use 5 mL of sustrates (liquid LB and MME)
    5 KB (744 words) - 03:56, 29 October 2011
  • Team:Arizona State/Notebook/June
    :* 5 g peptone :* 2.5 g yeast extract
    12 KB (1,827 words) - 02:05, 29 September 2011
  • Team:Nevada/Notebook/Weeks58
    ...ef="https://2011.igem.org/Team:Nevada/Notebook/Weeks58"><font size=4>Weeks 5-8</font></a>&nbsp;&nbsp;&nbsp; <font size=6>Calender Weeks 5-8</font>
    23 KB (3,836 words) - 03:00, 29 September 2011
  • Team:Sevilla/Week1
    <img style="z-index:-5;margin-top:-53px;margin-left:73px;" src="https://static.igem.org/mediawiki/ ...nsfer the cultures to 50 ml of LB and let grow until it reaches an OD of 0,5</p>
    10 KB (1,391 words) - 17:01, 21 September 2011
  • Reporter: Week 8 July 3-July 9
    ===Assembly of Fusion Parts, Day 5=== ...e stored in the 4&deg;C fridge until they could be sent to sequencing on 7/5.
    6 KB (882 words) - 00:00, 31 July 2011
  • Team:Harvard/ZF Binding Site Finder
    5'-<input type="text" id="bottominput" value="Input 9-bp site here" class="gr 5'-<input type="text" id="topinput" value="Input 9-bp site here" class="grayt
    16 KB (1,692 words) - 03:42, 29 September 2011
  • Team:Fudan/Lab
    arr[5]="https://static.igem.org/mediawiki/2011/9/9e/Fudan_lab_1.jpg"; i=Math.round(Math.random()*5+1)
    4 KB (608 words) - 03:50, 6 October 2011
  • Team:Fudan-Shanghai/Lab
    arr[5]="https://static.igem.org/mediawiki/2011/9/9e/Fudan_lab_1.jpg"; i=Math.round(Math.random()*5+1)
    4 KB (608 words) - 18:02, 5 October 2011
  • Team:Wisconsin-Madison/notebookprotocols
    <ol><li> Pellet the overnight culture(s) in a 1.5 ml or 2ml eppendorf tube. (I usually do 10,000 rpm, 3 minutes) 1 minute wo ...II. Invert 4-6 times to mix. Do not allow reaction to lyse for more than 5 min. Sample should clarify.
    24 KB (3,605 words) - 16:25, 8 August 2011
  • Team:Peking S/lab/notebook/shd
    |style="text-align:center"| 5 Electrophoresis PCR reaction system in 1.5% agarose gel.
    19 KB (2,592 words) - 05:05, 5 October 2011
  • Team:Freiburg/Notebook/18 August
    ...left:0.075in;padding-right:0.075in;"| Continue from Experiment: Cloning: ε5 was empty and the products from the cloning of 12.08.11 contain GFP-pbd too ε5 was empty and the products from the cloning of 12.08.11 contain GFP-pbd too
    12 KB (1,424 words) - 01:09, 22 September 2011
  • Team:DTU-Denmark-2/Notebook/Lab notes
    ...011.igem.org/Team:DTU-Denmark-2/Notebook/Lab_notes#Week 5"class="h2"> Week 5</a><br> We have had some difficulty with obtaining 5 of our new biobricks; SV40+ori, SV40 pA, LacZ, pyrG and pyrG-DR. We ran a t
    47 KB (7,731 words) - 16:49, 21 September 2011
  • Team:Tec-Monterrey/projectresults
    padding:5; ...T (14)IF (15)SF. (b) Rosetta Gami TI (1)IF (2)SF - TNI (3)IF (4) SF - WT (5)IF (6)SF. BW27783 TI (7)IF (8)SF - TNI (9)IF (10) SF - WT (11)IF (12)SF.(1
    24 KB (3,144 words) - 21:16, 20 October 2011
  • Team:Paris Bettencourt/GFP diff
    ...btilis</i> in exponential phase were mixed (ratio 1:1) on an LB-agarose (1.5%) slab and sealed in a microscope slide cavity. The aim is to obtain a <em> ...0px|thumb|center|3610 gfp- and 3610 gfp+ strains at 37°C t=0 min position 5 (trans image)]]
    7 KB (1,115 words) - 19:35, 18 October 2011
  • Team:UNIPV-Pavia/Calendar/August/week5
    AUGUST: WEEK 5 T9002-ENTERo and ENTERO-RBS were diluted 1:500 in M9 + Amp + Cm12.5 13 ml and 1 ml volume respectively. After six hour growth they were aliquot
    11 KB (1,795 words) - 10:12, 18 September 2011
  • Team:Freiburg/Notebook/5 September
    <a href="https://2011.igem.org/Team:Freiburg/Notebook"> 5 September </a> ...em to see if they have an insert of the modified Lysis genes K124017. Nr1, 5 and 7 were sent for sequencing since the size seems to be about right.
    27 KB (2,935 words) - 00:26, 22 September 2011
  • Team:Imperial College London/Extras/Protocols
    - Let competent cell strain 5α thaw for around 10 minutes on ice.<br> - Add 5μl on a chloramphenicol agar plate (concentration of 35μg/ml).<br>
    16 KB (2,829 words) - 09:34, 13 September 2011
  • Team:Imperial College London/Project Auxin Modelling
    ...aH. The whole tryptophan IAA pathway model is described in Equation 1<sup>[5]</sup>, and the parameters are defined in the parameters section below. <p> - N can be any real number. If N = 1.5, if means that N can be either 1 or 2.</p>
    22 KB (3,480 words) - 03:33, 29 October 2011
  • Team:Paris Liliane Bettencourt/Notebook/2011/09/15/
    ...50px|thumb|center|3610 gfp- and 3610 gfp+ strains at 37°C t=0min position 5 (trans image)]] ...50px|thumb|center|3610 gfp- and 3610 gfp+ strains at 37°C t=0min position 5 (gfp image)]]
    8 KB (1,140 words) - 14:58, 20 September 2011
  • Team:Bielefeld-Germany/Results/BPA
    ...Bielefeld-Germany2011_K123000K123001char.jpg|650px|center|thumb| '''Figure 5: BPA degradation by ''E. coli'' KRX carrying genes for BisdA and BisdB (onl ...ielefeld-Germany2011-model-ecoliBPA.png|center|220px]] <div align="right">(5)</div>
    37 KB (5,183 words) - 03:23, 29 October 2011
  • Team:Glasgow/Lovcharacterisation
    ... column load, the flow-through fraction and each eluate were mixed with 12.5µl of 2xSDS loading buffer (giving a final volume of 25µl). This was then ...he volume of which was calculated so that the standard curve would cover 0.5-10µg of BSA. A control containing no protein was also included in the sta
    11 KB (1,869 words) - 05:09, 22 September 2011
  • Team:Grenoble/Projet/Results/rmsA
    ... switch in the absence of a regulation system. An initial concentration of 5% of the maximum TetR (MerR) repressor concentration is considered in this e Figure 5:
    27 KB (3,568 words) - 02:40, 29 October 2011
  • Team:Johns Hopkins/Modeling/Para
    {| border="1" cellpadding="5" cellspacing="0" style="margin-left:30px;" |<sup>[[#Foot5|[5]]]</sup>
    6 KB (767 words) - 22:00, 28 September 2011
  • Team:MIT/Tools/
    ... found that a fairly large range of reasonable values extending outside of 5&lt;b_L&lt;50 generates patterning. ...MATLAB. We generated a system of several thousand ODEs, in which groups of 5 ODEs represented the state of a single cell, and were coupled to ODEs descr
    32 KB (5,458 words) - 04:02, 29 October 2011
  • Team:Brown-Stanford/Lab/Notebook/Week13
    == ''' September 5, 2011''' == *miniprep of liq cultures from 9/5
    4 KB (651 words) - 18:11, 28 September 2011
  • Team:UNAM-Genomics Mexico/Notebook/nifH
    ==Week: August 1 - August 5== ... the E0240 plasmid with EcoRI and XbaI. Afterwards we dephosphorylated the 5’ ends in the digested E0240 and ligated it to the previously digested nif
    13 KB (2,129 words) - 21:37, 28 September 2011
  • Team:UNAM-Genomics Mexico/Notebook/repC
    ==Week: September 5 - September 11== ... replated and extracted the plasmid of five repC bacterial colonies (1, 2, 5, 6, 9).We performed more ligation reactions with different insert:vector ra
    8 KB (1,256 words) - 19:48, 28 September 2011
  • Team:Alberta/Methodology/Notebook/Genetics
    <li>5' FadD-Untranslated Region (5'-UTR), thioesterase, Hygromycin B resistance, and 3' FadD-Untranslated Regi <h4>Week 5 May 22-28</h4>
    30 KB (4,672 words) - 23:06, 28 September 2011
  • Team:UNAM-Genomics Mexico/Notebook/hydaopt
    '''''CAI optimization and 5'UTR ΔGibbs optimization control'''''. We also modified the 5'UTR and a small portion of the coding region in the amino terminus that min
    6 KB (1,015 words) - 04:30, 29 September 2011
  • Team:KIT-Kyoto/GFP-MLF実験９月
    ↓1.5 mlチューブ中のゲルスライスの重さを量った<BR> ↓カラムを新しい1.5 mlチューブに移しかえた<BR>
    32 KB (3,437 words) - 09:14, 3 October 2011
  • Team:Tokyo Tech/Modeling/Urea-cooler/tables
    <li><a href="#table5">Table 5</a></li> <td>EC: 6.3.4.5 (<span class="gene">argG</span>)</td>
    18 KB (2,482 words) - 14:54, 28 October 2011
  • Team:ZJU-China/October.html
    ...<br/>22B+10I -1,-2,-3,-4 Vgb+1C3<br/>Fdhf+2M+20H -1,-2,-3,-4 Vgb+2I -1,-2,-5</td> <td >•Colony PCR:fdhf+2M+20H 5-14<br/>•Cultivate:fdhf+2M+20H 5-14<br/>•Cut:fdhf+2M,20H</td>
    20 KB (2,874 words) - 18:41, 28 October 2011
  • Team:Tokyo Tech/Modeling/Urea-cooler/urea-cooler
    Fig. 5 The reactions related with the urea cycle ...by <i>E. coli</i>. The scheme the overall reaction system is shown in Fig. 5 below.
    22 KB (3,325 words) - 13:45, 28 October 2011
  • Team:Kyoto/Measurement
    #; Big Dye Terminator 3.1: 0.5&micro;L #Bring up E.coli at 0,5,10,15,20,25,30,60min and extracted RNA and synthesized cDNA.
    8 KB (1,183 words) - 03:34, 6 October 2011
  • Team:OUC-China/Result/week12
    <li><a href="/Team:OUC-China/Result/week5">Week 5</a></li> <p>The plates which are used for standerdizing 18-3-11,14-19,5-4,rhiABCpro,13-6-leu and 18-3-11-6-leuB have already bacteria. And we selec
    7 KB (1,143 words) - 02:38, 29 October 2011
  • Team:SJTU-BioX-Shanghai/Project/Subproject1/Modeling
    ... can be described by double-substrate Michaelis-Menten equation as formula 5. [[image:11sjtu_formula 5.png|600px]]
    9 KB (1,406 words) - 18:47, 28 October 2011
  • Team:XMU-China/Project/Protocols
    •Collect 1-5 mL bacterium fluid in 1.5 mL centrifuge tube，and centrifuge fluid at 12000 r/min System1、2、3 and 4 are used for Standard BioBrick Assembly .System 5 and 6 are used for Restriction analysis. Digestion of sample: at least 500
    9 KB (1,326 words) - 02:29, 6 October 2011
  • Team:Peking S/project/wire/harvest
    ...fuged cells and resuspended them in phosphate buffer solution (PBS)(Figure.5). Experment result testify salicylate system work. Figure 5. Salicylate verify experiment result. The tube on the left side is control
    12 KB (1,698 words) - 04:02, 6 October 2011
  • Team:Harvard/Results/Test
    ...A3 will be expressed, and the cell will convert 5-FOA to the toxic product 5-fluorouracil, causing cell death. An alternate method of selecting against ...le the HisB oligo deleted 6 in-frame nucleotides (694-699) coding for VE. 5 rounds of MAGE were performed in an EcNR2 E. coli line using both oligos si
    14 KB (2,225 words) - 02:27, 18 October 2011
  • Main Page
    ...en_link" href="https://2011.igem.org/World_Championship_Jamboree">November 5 - 7, 2011</a></li> <img src="https://static.igem.org/mediawiki/2011/5/50/2011_WCJ_Flickr.png"
    37 KB (5,807 words) - 19:11, 12 April 2012
  • Team:Cornell/Week 1
    <font size="5"> <i> June 5th - June 11th </i></font> ==Sunday, June 5==
    2 KB (261 words) - 04:00, 29 September 2011
  • Team:Virginia Tech/Notebook
    {| style=" background-color:#800000;" cellpadding="1" cellspacing="5" border="0" width="90%" align="center" ==Week of 5/23/2011==
    10 KB (1,606 words) - 03:56, 29 September 2011
  • Regions/Asia/Jamboree/Pre-regional Jamboree
    ...iGEM Asia Handbook</a></li><a href="https://static.igem.org/mediawiki/2011/5/5a/IGEM_2011_Jamboree_Handbook.pdf"><img src="https://igem.org/images/pdf_i <li><a href="#5">Submit your Safety Proposal </a></li>
    27 KB (4,381 words) - 12:45, 13 October 2011
  • Team:Wageningen UR/Project/CompleteProject1Description
    '''5''': LuxR-AHL dependent GFP expression allows the fluctuations in AHL conce '''Fig.5.''' ''BioBrick part K546001 forms the negative feedback loop component and
    19 KB (2,886 words) - 03:53, 22 September 2011
  • Main page archive
    <img src="https://static.igem.org/mediawiki/2010/5/5c/Prize_image.jpg" .... We will be hosting a new course on <b>Sunday, November 6th, at 5:00pm to 5:30pm in room 32-141</b>.</p>
    70 KB (10,988 words) - 22:42, 7 November 2011
  • Team:Yale/Notebook/Week4
    <li><a href="https://2011.igem.org/Team:Yale/Notebook/Week5">Week 5</a></li> <h1>Week 4: June 5-12</h1>
    7 KB (1,188 words) - 22:49, 27 September 2011
  • Reporter: Week 3 May 30- June 4
    |J33204 miniprep from 5/26/11 |Two colonies from plates from 5/30/11
    9 KB (1,317 words) - 17:23, 13 July 2011
  • Team:NTNU Trondheim/Journal Modeling
    ...erential equations numerically using the Runge Kutta method of order 4 and 5 == Tuesday 5/7 ==
    9 KB (1,376 words) - 15:24, 20 September 2011
  • Team:Waterloo/Project
    ...rans-esterification occurs between the 3'OH and the 5'phosphorous from the 5' end of the intron. Subsequent conformational rearrangements ensure that th ...ts utilize a guanosine nucleotide to bind another sequence to dislodge the 5' site, then the cleavage initializes another splicing event with the remain
    18 KB (2,786 words) - 17:06, 25 September 2011
  • RecA: Week 5, June 13-18
    ...tI in his lab. Dr. Salis also suggested doing longer restriction digest (4-5 hours instead of 1-2 hours) in order to obtain more DNA. ===RecAI Extraction Take 5, Day 1===
    5 KB (754 words) - 03:01, 29 September 2011
  • Team:UNICAMP-EMSE Brazil/Project
    '''Figure 5: Representation of Jedi bacteria containing device 2 (able to sense high le :5. '''Experience'''
    48 KB (7,224 words) - 00:43, 29 October 2011
  • Team:Nevada/Notebook/Temp2
    <a href="https://2011.igem.org/Team:Nevada/Notebook/Temp2"><font size=4>Weeks 5-8</font></a>&nbsp;&nbsp;&nbsp; =='''Week 5 - June 27th- July 3rd'''==
    7 KB (1,152 words) - 18:53, 4 August 2011
  • Team:Imperial College London/Extras/Brainstorming
    - has been used to optimize the 1-deoxy-d-xylulose-5-phosphate (DXP) biosynthesis pathway in E.coli for isoprenoid lycopene over -The decomposition process is slow (i.e. leaves require 5 months to 2 years to decompose), could combine with Nick’s gene
    67 KB (10,740 words) - 10:07, 22 July 2011
  • Team:Arizona State/Project/CRISPR
    ...{{:Team:Arizona State/Templates/ref|63}}. This is a protein complex of all 5 Cse genes, resembling a seahorse in shape{{:Team:Arizona State/Templates/re ...am:Arizona State/Templates/ref|27}}, 21 bp forming a hairpin at 3', with a 5' hydroxyl group). crRNA is then typically bound to a protein complex (known
    16 KB (2,419 words) - 02:53, 29 September 2011
  • Team:BU Wellesley Software/Notebook/ShannonNotebook
    <script src="http://cdn.jquerytools.org/1.2.5/full/jquery.tools.min.js?foo"></script> | 1.5
    20 KB (2,751 words) - 01:27, 29 September 2011
  • RecA: Week 8, July 3-9
    ==Tuesday, July 5== The cloning attempt from 7/5 was verified through gel electrophoresis. The RecAI looked like the correct
    3 KB (463 words) - 03:02, 29 September 2011
  • Team:Cornell/Results
    ::*Flow Rate - 5 µL/min ::*Test - NeutrAvidin coated chip through which we flowed a 5:1 ratio of lysate to ATTO 520.
    16 KB (2,419 words) - 03:07, 29 October 2011
  • Team:Amsterdam/Notebook/Protocols/Miniprepping
    <li>Use 1-5 ml E.coli culture in LB media for purification of high copy plasmids.</li>< <li>Pellet 1-5 ml of culture by centrifuging 5 minutes in 2ml Eppendorf tube. If the volume of the culture exceeds 2 ml, f
    3 KB (467 words) - 23:59, 21 September 2011
  • Team:Harvard/Template:NotebookDataJuly4
    ***95˚ C, for 5 min ***72˚ C, for 5 min
    29 KB (4,742 words) - 19:22, 3 August 2011
  • Team:Osaka/Notebook
    <h4>Week 5</h4> |[[Team:Osaka/week1#August 5 (Fri)|5]]<span style={{{s5|"color:{{{c5|inherit}}};"}}}></span>
    12 KB (1,674 words) - 10:32, 28 October 2011
  • Team:KIT-Kyoto/Notebook/Protocol
    :<tr><td align=center>bacto yeast evtract</td><td align=right>5 g</td></tr> :↓Add 1~5µl of DNA solution to the 100µl of competent cells, then incubate for 30 m
    5 KB (911 words) - 03:02, 6 October 2011
  • Team:DTU-Denmark-2/Project/introduction
    ...logical system. This course grew to a summer competition in 2004 with just 5 teams, and since then the competition has expanded dramatically with more t ...ible with the concept of USER cloning, since they can read through uracil (5).</p>
    13 KB (1,954 words) - 21:42, 21 September 2011
  • Labjournal may
    0,5 g Agarose, 50 ml TAE (1%), 2 µl GELRED (3-6µl), at 100 Volt,running <br> <td>5 µl </td>
    17 KB (2,404 words) - 15:34, 5 September 2011
  • Team:ETH Zurich/Modeling/Parameters
    |[[Team:ETH_Zurich/Modeling/References#Ref5|[5]]] |0.5 1/(μM<sup>3</sup>*min)
    9 KB (1,219 words) - 13:36, 28 October 2011
  • Team:Imperial College London/Project/Chemotaxis/Modelling
    ...te signals that control the direction of rotation of the flagellar motors [5]. The signaling currency is in the form of phosphoryl groups (p), made ava ...on and the lower threshold and staturation level were also studied (Figure 5). </p>
    12 KB (1,889 words) - 10:18, 15 September 2011
  • Team:Potsdam Bioware/Labjournal/May
    0,5 g Agarose, 50 ml TAE (1%), 2 µl GelRed (3-6µl), at 100 Volt,running time: <td>5 µl </td>
    16 KB (2,275 words) - 17:57, 21 September 2011
  • Team:Imperial College London/Protocols General
    <p>- Add 3-5 μl of DNA to the cells</p> <p>- Spread 5 μl onto one agar plate, and then pour the rest onto another. Incubate the
    5 KB (838 words) - 01:31, 21 September 2011
  • Team:HokkaidoU Japan/Project/T3SS
    ...he bacteria were exposed to the cells (RK13) under acidic pH condition (pH=5.0), which is considered to be similar to the environment inside of the phag [[Image:HokkaidoU_T3SS_Fig5.jpg|left|thumb|500px|Fig. 5]]
    7 KB (1,100 words) - 16:22, 5 October 2011
  • Team:Harvard/Technology/One-Hybrid Selection System
    ... media. 5-AT is a selective inhibitor of histidine synthase. Addition of 5-AT would thus select against weak zinc finger binders, leaving only the str ... similar saturation levels to cultures grown in NM+histidine. Addition of 5-FOA killed the Zif268 cultures because of their expression of URA3 but did
    7 KB (1,050 words) - 16:13, 25 September 2011
  • Team:Kyoto/Digestion
    ...and changes into 3-amino-5-nitorosalicylic acid, whose color is brawn. [4][5]<br> =='''5.Achievment'''==
    9 KB (1,391 words) - 03:59, 6 October 2011
  • Team:ULB-Brussels/mat
    <p>5’-<span class="vert">gagcaaaaggccagcaaaaggccaggaaccgtaaaaaggc</span>tgccac <p>5’-<span class="vert">c</span><span class="vert">gtgagttttcgttccactgagcgtca
    29 KB (4,276 words) - 02:03, 22 September 2011
  • Team:HokkaidoU Japan/Project/Backbone
    ...7 bases downstream from first base recognised by Bsa I. Which results in a 5 prime 4 base overhang structure (Fig. 2). This is a key property that enabl 5'...GGTCTCN^.......3'
    3 KB (439 words) - 12:38, 15 December 2011
  • Team:BYU Provo/Team Thermosensor/Week3
    ===5/2/11=== Set up overnights using colonies 4 and 5 (the faint bands were darkest here). We plan to have these colonies sequenc
    943 B (140 words) - 02:24, 24 September 2011
  • Team:BYU Provo/Team Thermosensor/Week22
    * Plates checked at 1:00 Hour 5 -Devin Look at 5-1 at 3:00
    2 KB (323 words) - 21:00, 28 September 2011
  • Team:UCSF/MGFP5
    <regulartext>Mgfp-5 is an adhesive protein present in the foot of mussels. It is known to be an mgfp-5 on the surface of S. cerevisiae to enhance its adherence to materials such
    3 KB (409 words) - 02:19, 29 September 2011
  • Team:Harvard/Results/One-Hybrid Selection
    ...A3 will be expressed, and the cell will convert 5-FOA to the toxic product 5-fluorouracil, causing cell death. An alternate method of selecting against ...le the HisB oligo deleted 6 in-frame nucleotides (694-699) coding for VE. 5 rounds of MAGE were performed in an EcNR2 E. coli line using both oligos si
    12 KB (1,939 words) - 03:45, 29 September 2011
  • Team:UIUC-Illinois/Notebook
    ...en transformed with the helper plasmid (pAH57) and that have been grown in 5 mL SOB to an OD of 600nm of ca. 0.6 with ampicillin antibiotic at 30 degC. <div class="desc">95C 5 min</div>
    11 KB (1,539 words) - 04:01, 29 September 2011
  • Team:KIT-Kyoto/ぷろとこる英語
    <tr><td align=center>bacto yeast evtract</td><td align=right>5 g</td></tr> ↓Add 1~5µl of DNA solution to the 100µl of competent cells, then incubate for 30 m
    4 KB (742 words) - 12:49, 4 October 2011
  • Team:IIT Madras/Notebook/Protocols
    <li>Primary culture in 5 ml of LB broth for 16 hours.</li> <li>Check OD600 after 1 hour, 1.5 hours, 2 hours.</li>
    6 KB (946 words) - 00:30, 29 October 2011
  • Team:NYMU-Taipei/optomagnetic-design
    ==<font size=5><font color=crimson>'''Optomagnetic Design'''</font>== '''<font size=5><font color=gray>Follow up!</font></font>'''
    18 KB (2,832 words) - 22:35, 28 October 2011
  • Team:OUC-China/Result/week4
    <li><a href="/Team:OUC-China/Result/week5">Week 5</a></li> 2. Later at 17:00, extract plasmid from No.5, 4, 6, 2 part.
    6 KB (859 words) - 02:36, 29 October 2011
  • Team:OUC-China/Result/week8
    <li><a href="/Team:OUC-China/Result/week5">Week 5</a></li> <p>The inoculated 5&4，leu,21&3,22&3 grew normally. And we selected the single colonies and in
    7 KB (1,115 words) - 02:37, 29 October 2011
  • Team:SJTU-BioX-Shanghai/Notebook/Lablog1
    ==8/5/2011== T7-F:5'-GCGGTGCGGACTGTTGTATTAATACGACTCACTATAGGGG-3'
    31 KB (4,713 words) - 15:15, 5 October 2011
  • Team:Freiburg/Notebook
    | bgcolor="#FFFFFF" | [[Team:Freiburg/5_April|5]] | bgcolor="#FFFFFF" | [[Team:Freiburg/Notebook/5_May|5]]
    13 KB (1,543 words) - 02:08, 22 September 2011
  • Team:WarrenCIndpls IN-HS/Project
    5) Place the loop into the corresponding tube and swivel the loop a few tim 6) Repeat 4-5 with the E.Coli containing M-Cherry.
    4 KB (624 words) - 14:15, 25 June 2011
  • Team:SouthBend-Mishawaka-HS-2
    z-index:5; partsarray[1].src="https://static.igem.org/mediawiki/2010/5/57/Parts_none.png";
    10 KB (1,356 words) - 17:14, 24 June 2011
  • Team:SouthBend-Mishawaka-HS-2/Attributions
    https://static.igem.org/mediawiki/2010/5/5f/Osli_official_logo_26h.png z-index:5;
    9 KB (1,277 words) - 17:09, 24 June 2011
  • Team:BU Wellesley Software/Notebook/JanooNotebook
    <script src="http://cdn.jquerytools.org/1.2.5/full/jquery.tools.min.js?foo"></script> ''The Assembly Planner [5] is the end-point of an endto-
    48 KB (7,116 words) - 22:00, 27 September 2011
  • Team:EPF-Lausanne/Protocols/TetR
    *0.5 µl of each primer *0.5 µl High Fidelity Polymerase
    3 KB (452 words) - 08:48, 15 July 2011
  • Team:BU Wellesley Software/Notebook/MargauxNotebook
    <script src="http://cdn.jquerytools.org/1.2.5/full/jquery.tools.min.js?foo"></script> -6.5% (strength)
    30 KB (4,744 words) - 23:34, 27 September 2011
  • Team:Freiburg/Notebook/2 August
    ...p:0in;padding-bottom:0in;padding-left:0.075in;padding-right:0.075in;"| 117,5 ...g-top:0in;padding-bottom:0in;padding-left:0.075in;padding-right:0.075in;"| 5
    9 KB (1,066 words) - 01:04, 22 September 2011
  • Reporter: Week 5 June 12-17
    |0.5 |0.5
    10 KB (1,638 words) - 17:26, 13 July 2011
  • Team:Freiburg/Notebook/12 August
    |5 ...op:0in;padding-bottom:0in;padding-left:0.075in;padding-right:0.075in;"| 96,5
    20 KB (2,362 words) - 01:07, 22 September 2011
  • Team:Freiburg/Notebook/22 August
    ...order-left:0.0139in solid #808080;border-right:none;padding:0.0194in;"| 32,5µl ...border-left:0.0139in solid #808080;border-right:none;padding:0.0194in;"| 2.5µl
    17 KB (1,983 words) - 01:11, 22 September 2011
  • Team:UNIPV-Pavia/Calendar/August/week1
    ...for E28-AGAIN and E41-AGAIN plates were picked and inoculated in LB + Cm12.5; J101-31, J101-E5 and J101-E7 plasmids were extracted: <td class="row">14.5</td>
    13 KB (2,104 words) - 10:02, 18 September 2011
  • Team:Cambridge/Experiments/Synthetic Reflectin PCR and Construction of GA1 to 6
    |60.5&deg;C |'''5'''
    32 KB (4,807 words) - 20:10, 21 September 2011
  • Team:Osaka/week1
    ...: 1px; border-style: solid; border-color: #000; padding:5px;" cellpadding="5" ==August 5 (Fri)==
    4 KB (586 words) - 05:53, 19 October 2011
  • Team:Edinburgh/Cellulases (C model)
    ...to the above, [[Team:Edinburgh/Syn Animation | here]].<br>'''Warning:''' 1.5 MB file, has been known to hang certain browsers... ...ion of exoglucanase by nearby cellobiose, endoglucanase requiring at least 5 sugars on each side of a bond to cut it).
    11 KB (1,687 words) - 19:10, 16 October 2011
  • Team:UNICAMP-EMSE Brazil/protocols/chimiocompetent prepare
    ==<font size="5" color=#086A87>Preparation of Chemically competent ''E. coli'' cells== ::{|border="1" cellpadding="5" cellspacing="0" align="left"
    7 KB (1,090 words) - 20:27, 27 September 2011
  • Team:UNICAMP-EMSE Brazil/protocols/thermocompetent prepare
    ==<font size="5" color=#086A87>Preparation of Thermocompetent ''E. coli''== ::*To prepare a 5 M solution: Dissolve 292 g of NaCl in 800 ml of H2O. Adjust the volume to 1
    7 KB (1,186 words) - 01:23, 23 August 2011
  • Team:UTP-Panama/Week 11
    5. In each tube was added 5 mL of LB liquid. This LB containing an appropriate concentration of antibio • Put 2.5 to 5 micolitros Ethidium bromide. We mix before pouring it into the camera.
    4 KB (678 words) - 03:59, 29 September 2011
  • Team:UTP-Panama/Week 12
    In a 250mL Erlenmeyer we mixed 0.5 g agarose with 50 mL of 1X TAE (for electrophoresis gel). <br> 2. We heated in a microwave to dissolve (5 times of 20s each time stirring gently). <br>
    3 KB (464 words) - 04:57, 29 September 2011
  • Team:Paris Bettencourt/MultiHost
    Mannitol, Sorbitol, Trehalose, LB, glycerol (99,5%) <br> ...(Bio-rad) set on 200 ohms and 25 μF (≈ 5 ms pulses) and between 2 and 2.5 kV <br>
    10 KB (1,472 words) - 09:42, 11 September 2011
  • Team:Paris Liliane Bettencourt/Notebook/2011/08/30/
    * 5 Miniprep prepared ===extraction of ComS from 5 different colonies===
    2 KB (272 words) - 15:21, 3 September 2011
  • Team:BYU Provo/Team OxyR/The Beginning
    ==5 January 2011== ... there is nothing important downstream. When heated, the promoter inverts (5' to 3' as well as switching strands), leading to transcription in the oppos
    19 KB (2,820 words) - 23:01, 27 September 2011
  • Team:ETH Zurich/Modeling/Microfluidics
    ... [[Team:ETH_Zurich/Modeling/Parameters#Diffusion_Model|z<sub>end</sub>]] = 5 cm long cylindrical channel with a radius of [[Team:ETH_Zurich/Modeling/Par ...|thumb|'''Figure 1:''' 3D acetaldehyde concentration in mol/m<sup>3</sup>, 5 slices through the channel. Channel width: 2 mm, reservoir acetaldehyde con
    18 KB (2,727 words) - 22:28, 28 October 2011
  • Team:HokkaidoU Japan/Notebook
    ...R product would be full of smear because our forward primer is annealed to 5' terminal of double terminator seaquence. Thus, we thought it is nice to cu ===Week 5: Aug. 28th - Sep. 3rd===
    18 KB (2,654 words) - 03:20, 5 October 2011
  • Team:WITS-CSIR SA/js/lib/jquery-ui-1.8.14.custom.min.js
    ...d.ui.keyCode.PAGE_DOWN:h=b._trimAlignValue(i-(b._valueMax()-b._valueMin())/5);break;case d.ui.keyCode.UP:case d.ui.keyCode.RIGHT:if(i===b._valueMax())re ...Math.abs(c)*2>=a)alignValue+=c>0?a:-a;return parseFloat(alignValue.toFixed(5))},_valueMin:function(){return this.options.min},_valueMax:function(){retur
    205 KB (32,858 words) - 08:15, 3 September 2011
  • Team:DTU-Denmark-2/Project/Other assembly systems
    The assembly system employs 5´-T5 exonuclease, Phusion DNA polymerase, and Taq ligase. Gibson can be use The isothermal 5´-T5 exonuclease removes the bases from the 5'-end of double stranded DNA, leaving a recess in the DNA. The ssDNA overhan
    16 KB (2,551 words) - 00:26, 22 September 2011
  • Team:NYC Wetware/Deinococcus/Cell Damage
    Damage to the protein may include damage to the active site of ribulose-5-phosphate-3-epimerase.<img src="http://www.proteopedia.org/wiki/images/d/d2 Chest x-ray = 8 x 10^-5 Gray per x-ray<br/>
    7 KB (1,183 words) - 16:23, 12 October 2011
  • Team:WHU-China/Team/Gallary
    ... type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.5.2/jquery.min.js"></script> size : 5,
    11 KB (1,573 words) - 07:45, 23 October 2011
  • Team:Potsdam Bioware/Safety Ethics
    On the 5. July 2011 the iGEM Team Potsdam hosted a lecture about ethics in the field knowledge, Miller and Selgelid [5] show in their paper, that new applications in biology also can used for mi
    22 KB (3,483 words) - 02:11, 29 October 2011
  • Team:Imperial College London/Project Gene Modelling
    ...s pUC19-derived pMB1 replication origin (~100-300 molecules per cell)<sup>[5]</sup>. The number of plasmids in bacteria ranges from 100 to 300 per cell. ...ysis occurs at a holin concentration equal to 1000 molecules/cell<sup>[1],[5],[6]</sup>, therefore we used this as the threshold concentration for cell
    10 KB (1,526 words) - 23:39, 16 October 2011
  • Team:HKUST-Hong Kong/asm.html
    <img src="https://static.igem.org/mediawiki/2011/5/54/Ust_refer.gif" width=100 height=100 alt="References"></a> <img src=https://static.igem.org/mediawiki/2011/5/59/Ust_Post-swap_pt.png width=750></center>
    24 KB (3,849 words) - 18:57, 28 October 2011
  • Team:Peking R/Notebook/XQY
    <th height="38" colspan="5" bgcolor="#FFFFFF" class="notbookmaintitle" scope="col">Xiao Qingyang's Not <th colspan="5" bgcolor="#FFFFFF" class="notbookmaintitle" scope="col"><hr /></th>
    13 KB (1,614 words) - 16:21, 19 October 2011
  • Team:UNICAMP-EMSE Brazil/Notebook/16 September 2011
    ...sis Gel 1, 16/09/2011.'''</font> <br>Gel 1: pSB1/ pSB 2/ pSB 3/ pSB 4/ pSB 5/ SoxS+ RBS+HlyB +RBS+HlyD+ RBS+TolC+T C1 1/ SoxS+ RBS+HlyB+ RBS+HlyD + RBS+ ...SB1C3 vector purified from the gel (volume of ladder applied 6 uL; sample: 5 uL DNA +1 uL buffer),
    7 KB (1,097 words) - 13:50, 18 September 2011
  • Team:Harvard/Template:NotebookDataAugust
    *All reagents were kept the same except template: 1µL, 1.5, 2, 2.5, 3, 3.5, or 4µL were used *0.5 ul of BsaI-HF
    26 KB (4,211 words) - 22:44, 19 September 2011
  • Team:Bilkent UNAM Turkey/Protocols
    background: url(https://static.igem.org/mediawiki/2011/5/56/B.jpg) repeat-x left top; background: url(https://static.igem.org/mediawiki/2011/5/56/B.jpg) repeat-x left top;
    14 KB (2,028 words) - 01:55, 22 September 2011
  • Team:UNAM-Genomics Mexico/Project/RhizobialKit
    ...nsformed ''E. coli'' cells. This plasmid is a modification of the pBBR1MCS-5 plasmid, which is a broad-host-range (bhr) vector designed to assist geneti ...o the pBBR1MCS-5. [[Team:UNAM-Genomics_Mexico/Notebook/pBBR1MCS-5|pBBR1MCS-5 Logbook]].
    8 KB (1,232 words) - 03:36, 29 September 2011
  • Team:EPF-Lausanne/Our Project/TetR mutants/MITOMI data
    | 5||0.164072||1.19894||1.79469||1.56685 | 5||0.164072||1.19894||1.79469||1.56685
    16 KB (1,939 words) - 21:49, 26 October 2011
  • Team:DTU-Denmark/Background sRNA
    ... nucleotides and often require Hfq<span class="superscript">[[#References|[5]]]</span>. We are focusing on trans-encoded sRNA in the project, so '''when ...eems to be critical for regulation<span class="superscript">[[#References|[5]]]</span><span class="superscript">[[#References|[7]]]</span>. This (often
    11 KB (1,648 words) - 04:44, 22 September 2011
  • Team:DTU-Denmark/Project improving araBAD
    ...l downstream of the KpnI and amplify the 3' end of GFP in conjunction with 5 different primers designed to overlap the arabinose promoter and introduce ...|[5]]]</span> of both the rationally designed promoters and SPL. '''Figure 5''' depicts that 6 of the mutated promoters are characterized by a higher ac
    13 KB (2,036 words) - 03:54, 22 September 2011
  • Team:BYU Provo/Team Thermosensor/Week5
    ==Week 5 (May 8-14)== ===5/20/11===
    820 B (110 words) - 02:27, 24 September 2011
  • Team:Johns Hopkins/Notebook/Baking
    {| border="1" cellpadding="5" cellspacing="0" style="margin-left:40px;" {| border="1" cellpadding="5" cellspacing="0" style="margin-left:40px;"
    7 KB (1,034 words) - 01:02, 29 October 2011
  • Team:Calgary/Notebook/Calendar/Binf
    ...some of our results, the main focus this week has been on selecting around 5 or 6 genes that are responsive to naphthenic acids. We want genes which tu <h3>August 5-12, 2011</h3>
    26 KB (4,353 words) - 03:58, 29 October 2011
  • Team:USC/Notebook/Week6
    [[Team:USC/Notebook/Week5|Week 5]] [[File:week5.jpg|link=Team:USC/Notebook/Week5|Week 5]]
    7 KB (908 words) - 03:57, 29 September 2011
  • Team:UT Dallas/protocols new
    ...min. at 13,000rpm</li><li type="disk">Place QIAquick column into a clean 1.5 mL microcentrifuge tube</li><li type="disk">To elute DNA, add 50uL of Buffe ...<li type="circle">5uL of appropriate enzyme (if doing a double digest, use 5 uL of both enzymes)</li><li type="circle">Amount of H2O needed to make fina
    14 KB (2,139 words) - 03:41, 29 September 2011
  • Team:Harvard/Project/Bioinformatics
    ...d position in a backbone. Amino acid positions are specified by -1,1,2,3,4,5, and 6. ...e on opposite DNA strands, and are separated by a spacer that is typically 5-7 bp long.
    22 KB (3,444 words) - 03:40, 29 September 2011
  • Team:Yale/Parts
    ...n to screen for ones containing our insert. Lane 1: 100bp ladder, Lanes 3, 5 and 6 show amplification of our insert; these colonies were subsequently mi ... RBS-eGFP-TEV-RiAFP-His-Terminator, Lane 4: RBS-RiAFP-His-Terminator, Lane 5: RBS-His-eGFP-TmAFP-Terminator, Lane 6: RBS-TmAFP-His-Terminator, Lane 7: R
    6 KB (790 words) - 15:20, 28 October 2011
  • Team:UNICAMP-EMSE Brazil/Results
    ... inducer in bacteria. Final Paraquat concentrations were: 0 μM (control), 5 μM, 10 μM, 20 μM, 30 μM and 40 μM. Induction of the designed sensor/ef ...lign=center>'''Figure 2: SoxS/SoxR fluorescence data for concentrations 0, 5, 10, 20, 30 and 40 µM of inducer (Paraquat).'''</div>
    20 KB (2,998 words) - 00:28, 29 October 2011
  • Team:Brown-Stanford/REGObricks/Biobrick
    ...1C3 (lane 3) and of our urease construct/PCR product (lane 4). Lanes 1 and 5 display 1 kb ladders; the last two lanes are spurious data. ...3 + J04450 (lanes 2, 3) and of the urease construct/PCR product (lanes 4, 5, 6).]] [[File:Successful ligation product.jpg|300px|thumb|The above gel dep
    15 KB (2,266 words) - 01:31, 29 October 2011
  • Team:KIT-Kyoto/matsunami/8月
    <tr><td align=center>Anneling</td><td align=center>51.5°C</td><td align=center>30sec</td></tr> Tm値　56.5°C<br>
    39 KB (5,673 words) - 12:26, 4 October 2011
  • Team:Peking S/lab/notebook/cyw
    |style="text-align:center"| 5 In each step, we added around 30bp of the ptsG1’s 5’ untranslated region (5’ UTR) to the former product, and we finally got the construct for the fus
    15 KB (2,060 words) - 05:11, 5 October 2011
  • Team:Peking S/lab/notebook/qx
    ...each step, we added around 30bp of the ptsG1’s 5’ untranslated region (5’ UTR) to the former product, and we finally got the construct for the fus ...was as follows. We used 10-2 mol/L arabinose to induce the PBAD, and every 5 experimental groups are coupled with 2 controls, i.e. culture solution with
    9 KB (1,447 words) - 05:19, 5 October 2011
  • Team:NCTU Formosa/protocol F
    ...to a final O.D. 600 of 0.1 (1×108 cells per ml) in 14-ml tubes containing 5 ml M9 minimal medium, then different concentration aTc (0 ng/ml, 50 ng/ml,
    17 KB (2,606 words) - 13:40, 5 October 2011
  • Team:Peking S/project/blogic/extension
    ...ult. The concentrations of arabinose are 1e-7, 3e-7, 1e-6, 3e-6, 1e-5, 3e-5, 1e-4, 3e-4, 1e-3, 3e-3 and 1e-2, respectively. Fluorescence values and th ... have performed experiments to prove its sequential logic behavior (Figure 5), especially for the repeated switch between ON and OFF (Figure 6).
    10 KB (1,532 words) - 01:50, 6 October 2011
  • Team:HokkaidoU Japan/HumanPractice/Part6
    :: GFP 5 :: Suzuki Coupling (::4) 5
    6 KB (938 words) - 18:23, 5 October 2011
  • Team:Osaka/Notebook/diary
    |[[Team:Osaka/week1#August 5 (Fri)|5]]<span style={{{s5|"color:{{{c5|inherit}}};"}}}></span> |[[Team:Osaka/week6#September 5 (Mon)|5]]<span style={{{s5|"color:{{{c5|red}}};"}}}></span>
    10 KB (1,315 words) - 04:07, 5 October 2011
  • Team:USTC-China/Drylab/modeling
    ...;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;'''Fig. 5'''</p> of the cells grow under the rate of k=0.97*exp(-t/5), the unit
    21 KB (3,348 words) - 02:39, 29 October 2011
  • Team:OUC-China/Result/Protocol
    1.5*M9 solution 200ml<br> leucine: 5-10mg/100ml<br>
    12 KB (1,941 words) - 04:05, 6 October 2011
  • Team:ETH Zurich/Team/Human practices
    : □ 1 □ 2 □ 3 □ 4 □ 5 □ 6 □ 7 □ 8 □ 9 □ 10 : □ 1 □ 2 □ 3 □ 4 □ 5 □ 6 □ 7 □ 8 □ 9 □ 10
    12 KB (1,936 words) - 23:38, 28 October 2011
  • Team:Paris Bettencourt/Experiments/T7 diffusion experiments
    Emitter-Receiver (1:5 ratio) mix cells after 0 min incubation Emitter-Receiver (5:1 ratio) mix cells after 0 min incubation
    16 KB (2,516 words) - 03:58, 29 October 2011
  • Calendar of Events
    | Sep 21 || Sep 28 || Oct 5 || Project and part documentation due, including documentation for all meda | Sep 21 || Sep 28 || Oct 5 || BioBrick Part DNA due to the Registry
    2 KB (275 words) - 21:37, 16 October 2011
  • Team:Grenoble/Safety
    ...irulence, pathogenesis <a href="#4">(4)</a> ⁠and many more <a href="#5">(5)</a>⁠... ...sters the protein, allowing the expression of targeted genes <a href="#5">(5)</a>. In most systems, the binding site on the RNA leader sequence is a ste
    20 KB (3,229 words) - 20:50, 28 October 2011
  • Team:Bielefeld-Germany/Labjournal
    ==Week 5: 30th May - 5th June== ...ge:Bielefeld2011 Kult 07.07 RFU periplasm.png|450px|thumb|right| '''Figure 5: Relative fluorescence of the S-layer/mRFP fusion proteins in the periplasm
    32 KB (4,418 words) - 23:09, 28 October 2011
  • Team:TU-Delft/Team/Tania
    ... poles). The end of the week was mainly for study of the activation of mfp-5. Questions for the existence of tyrosinase in the periplasm and its degrada ...ell-surface adhesion, and the regulation of the adhesive properties of Mfp-5. On Friday afternoon the team had a meeting with the other three Dutch iGEM
    5 KB (891 words) - 15:53, 18 August 2011
  • Team:Wageningen UR/Softwaretool
    ...xample, you want to create the following hypothetical construct of 1-2-3-4-5-6. A number in this construct represents what we call a functional genetic <td>UANL_Mty-Mexico</td> <td>6</td> <td>5</td>
    5 KB (884 words) - 03:37, 22 September 2011
  • Team:Amsterdam/Notebook/Protocols/Purification
    <li>Use 1-5 ml (3 ml) E.coli culture in LB media for purification of high copy plasmids Note: Do not vortex, do not incubate for more than 5 minutes.
    2 KB (324 words) - 19:50, 16 September 2011
  • Team:EPF-Lausanne/Templates/jquery-easing
    if (t==0) return b; if ((t/=d/2)==2) return b+c; if (!p) p=d*(.3*1.5); if (t < 1) return -.5*(a*Math.pow(2,10*(t-=1)) * Math.sin( (t*d-s)*(2*Math.PI)/p )) + b;
    8 KB (1,292 words) - 13:18, 3 June 2011
  • Team:BU Wellesley Software/Notebook/TraciNotebook
    <script src="http://cdn.jquerytools.org/1.2.5/full/jquery.tools.min.js?foo"></script> 5. Ligations with the cut backbones and inserts
    15 KB (2,198 words) - 18:27, 27 September 2011
  • Team:BU Wellesley Software/Notebook/SiruiNotebook
    <script src="http://cdn.jquerytools.org/1.2.5/full/jquery.tools.min.js?foo"></script> ...ly: helvetica, arial, sans-serif;font-size:1em;color:#ea8828;"|<h3>Week of 5/31/2011</h3>
    29 KB (4,439 words) - 03:57, 29 September 2011
  • Agenda:Transformation Test Run
    ==='''Agenda:Transformation Test Run (5/19/2011)'''=== (4) Incubate on ice 5 minutes.
    1 KB (152 words) - 16:36, 4 June 2011
  • Agenda: Transforming Top 10 cells to Establish Hg sensitive promoter part K346002
    (1) 5 microliters of transformation media (BIO RAD Catalogue 166-0409 received 1- (3) Solution was placed in ice bath for 5 minutes.
    1 KB (172 words) - 16:47, 4 June 2011
  • Week 3: May 30-June 3
    &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;J33204 miniprep from 5/26/11 &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Two colonies from plates from 5/30/11
    6 KB (865 words) - 21:45, 7 June 2011
  • Team:Brown-Stanford/Templates/jquery.easing.1.3.js
    if (t==0) return b; if ((t/=d/2)==2) return b+c; if (!p) p=d*(.3*1.5); if (t < 1) return -.5*(a*Math.pow(2,10*(t-=1)) * Math.sin( (t*d-s)*(2*Math.PI)/p )) + b;
    8 KB (1,292 words) - 18:52, 6 June 2011
  • Team:Arizona State/Templates/jquery-easing
    if (t==0) return b; if ((t/=d/2)==2) return b+c; if (!p) p=d*(.3*1.5); if (t < 1) return -.5*(a*Math.pow(2,10*(t-=1)) * Math.sin( (t*d-s)*(2*Math.PI)/p )) + b;
    8 KB (1,292 words) - 21:37, 7 June 2011
  • Team:UNICAMP-EMSE Brazil/Results/Judging
    :5. '''Experience''' ...occus lactis secreting interleukin-10. Science. 2000 Aug 25;289(5483):1352-5.
    15 KB (2,208 words) - 18:49, 20 October 2011
  • Team:Brown-Stanford/Lab/Protocols/BG11
    ==== '''Stock 5 (Microelements)''' ==== Stock 5 (Microelements):
    2 KB (271 words) - 18:15, 28 September 2011
  • Team:BU Wellesley Software/Notebook/ChenkaiNotebook
    <script src="http://cdn.jquerytools.org/1.2.5/full/jquery.tools.min.js?foo"></script> ...used the same method to test 1 ligation and it worked fine, we then tested 5 ligations in a row and its pipetting pattern also matched what we expected.
    28 KB (4,611 words) - 16:34, 27 September 2011
  • Frank Machin's Lab Notebook
    <!--[if lt IE 5.5000]><style type="text/css">@import "/wiki/skins/igem/IE50Fixes.css?270";< <!--[if IE 5.5000]><style type="text/css">@import "/wiki/skins/igem/IE55Fixes.css?270";<
    25 KB (3,664 words) - 21:23, 3 July 2011
  • Agenda: Added Enzymes to E0840, J45119, and PSB1T3
    ...der to cut both ends of the wanted DNA. Also add .5 microliters of BSA and 5 microliters. ...der to cut both ends of the wanted DNA. Also add .5 microliters of BSA and 5 microliters.
    1 KB (170 words) - 01:23, 17 June 2011
  • Team:ETH Zurich/Modeling/Stochastic
    ...tart the simulations. For analyzing the robustness of the system, we chose 5 strategic Acetaldehyde concentrations (see Figure 1), and for each of them ...center|'''Figure 1''': GFP versus Acetaldehyde. The red squares denote the 5 Acetaldehyde concentrations for which we simulated the time course of GFP s
    9 KB (1,386 words) - 22:27, 28 October 2011
  • Team:Tokyo-NoKoGen/bmc
    <meta name="GENERATOR" content="Freeway 5 Express 5.6.1"> ...lass="style71">&#8544;. Constructs for characterizing PduBMC expression (1-5)</p>
    19 KB (2,695 words) - 01:30, 6 October 2011
  • Team:Paris Bettencourt/Notebook
    ...ttps://2011.igem.org/Team:Paris_Liliane_Bettencourt/Notebook/2011/06/05/"> 5</a></td> ...ttps://2011.igem.org/Team:Paris_Liliane_Bettencourt/Notebook/2011/07/05/"> 5</a></td>
    19 KB (2,638 words) - 09:33, 21 October 2011
  • Team:WashU/Notebook/Assay
    1. Pellet yeast cells by centrifuging for 5 minutes at 10,000g. 3. Add 1 g 0.50-0.75mm glass beads. Vortex for 5 min to break cells.
    4 KB (627 words) - 23:14, 27 September 2011
  • Team:Uppsala-Sweden/Project/Protocol
    * 0.5% (w/v) yeast extract * 2.5 mM KCl
    12 KB (1,960 words) - 23:24, 21 September 2011
  • Atipat Patharagulpong's Lab Notebook
    <!--[if lt IE 5.5000]><style type="text/css">@import "/wiki/skins/igem/IE50Fixes.css?270";< <!--[if IE 5.5000]><style type="text/css">@import "/wiki/skins/igem/IE55Fixes.css?270";<
    26 KB (3,696 words) - 20:45, 3 July 2011
  • Christopher Schoene's Lab Notebook
    <!--[if lt IE 5.5000]><style type="text/css">@import "/wiki/skins/igem/IE50Fixes.css?270";< <!--[if IE 5.5000]><style type="text/css">@import "/wiki/skins/igem/IE55Fixes.css?270";<
    24 KB (3,555 words) - 10:05, 4 July 2011
  • Nicolas Kral's Lab Notebook
    <!--[if lt IE 5.5000]><style type="text/css">@import "/wiki/skins/igem/IE50Fixes.css?270";< <!--[if IE 5.5000]><style type="text/css">@import "/wiki/skins/igem/IE55Fixes.css?270";<
    25 KB (3,696 words) - 10:08, 4 July 2011
  • Http://2011.igem.org/Team:NCTU Formosa
    if(page.substring(0, 5) == "User:") { if (anchor.substring(0,5)!='page=')
    31 KB (4,083 words) - 08:03, 5 July 2011
  • Team:Caltech/Week 7
    File:7-25pcrgel1.jpg|lane 1 NEB 2-log ladder, 2-4 pSB4A5, 5-7 R0040, 8-10 K123001, 11-13 B0014 File:7-25pcrgel2.jpg|lane 1 NEB 2-log ladder, 2-4 pNT003 insert, 5 R0010, 6 K123003, 7 B0014, 8 blank, 9-11 GFP insert, 12 GFP constitutive pr
    9 KB (1,486 words) - 20:58, 18 August 2011
  • Team:Alberta/Methodology/Parts
    <td>FadD 5'-UTR</td> <td>This is the 5'-UTR of the FadD gene of <i>N. crassa</i>. It is suitable for creating cons
    4 KB (539 words) - 21:37, 28 September 2011
  • Team:Caltech/Week 5
    ...e:7-11gelpNT003assem.jpg|thumb|left|1 ladder, 2 R0010, 3 K123003, 4 B0014, 5 pSB4A5]] ...humb|from left to right: 1 ladder, 2 R0010, 3 K123000, 4 B0014 for pNT002, 5 R0040, 6 K123001, 7 B0014 for pNT003, 8 B0014 for pNT001]]
    6 KB (1,056 words) - 18:25, 20 July 2011
  • Team:Freiburg/Notebook/25 July
    ...op:0in;padding-bottom:0in;padding-left:0.075in;padding-right:0.075in;"| 32,5µl ...top:0in;padding-bottom:0in;padding-left:0.075in;padding-right:0.075in;"| 2.5µl
    27 KB (3,137 words) - 01:00, 22 September 2011
  • Team:Harvard/Notebook
    if(k==5){ </tr><td>5</td><td>
    17 KB (2,366 words) - 23:06, 25 October 2011
  • Team:EPF-Lausanne/Protocols/Site-specific mutagenesis
    ...s digest the template (unmutated by definition) to leave only the mutants (5 minutes). ...nt cells: to repair nicks left in the plasmid by the extension reaction (1.5 hours).
    5 KB (791 words) - 07:45, 27 July 2011
  • Team:UNIPV-Pavia/Calendar/July/settimana3
    <td class="row">2.5</td> <td class="row">2.5</td>
    25 KB (4,067 words) - 14:29, 17 August 2011
  • Team:Cornell/Week 9
    <font size="5"> <i> July 31st - August 6th </i></font> :::5μL 10x NEBuffer 4
    5 KB (726 words) - 17:23, 18 September 2011
  • Team:Freiburg/Notebook/4 August
    5µl Buffer NEB4 <br/> 5µl BSA (10x) <br/>
    10 KB (1,257 words) - 01:05, 22 September 2011
  • Team:Caltech/Week 8
    <td>12.5</td> File:8-2pcrgel1.jpg|lane 1 NEB 2-log ladder, 2-4 pNT003 insert, 5-7 pNT003 insert with PIPE primers, 8-13 pSB3K3, 14-15 pETDEST53
    6 KB (927 words) - 17:19, 9 August 2011
  • Team:HKU-Hong Kong/Modelling
    ...s the binding domain of the tetracycline – magnesium complex, [MgTc]+, α5, α8 and α10 are helices of the rigid scaffold, within which α8 and α10 ...rial, sans-serif;color:#000000;margin- top:5px;padding: 2px;" cellspacing="5";
    7 KB (1,030 words) - 12:15, 5 October 2011
  • Regions/Americas/Pre-Jamboree
    * [[#5|2011 Regional Jamboree – Americas Schedule]] <span id="5"></span>
    22 KB (3,075 words) - 01:15, 29 September 2011
  • Team:Harvard/Template:NotebookDataJuly
    ...s protocols] for details). 5-FOA plates have a blue stripe, 3-AT plates (0.5 mL 3-AT) have a green stripe.</div> *Make other 3-AT plates (1.5)
    9 KB (1,439 words) - 18:13, 3 August 2011
  • Team:Imperial College London/Project/Background
    title[5] = "Australia"; text[5] = "In Australia, desertification and soil degradation are widespread probl
    14 KB (1,877 words) - 09:47, 25 October 2011
  • Team:KAIST-Korea/js/effects core
    case 'middle': y = 0.5; break; case 'center': x = 0.5; break;
    20 KB (2,682 words) - 10:37, 4 August 2011
  • Team:Tokyo Metropolitan/Notebook
    ...nter"><a href="https://2011.igem.org/Team:Tokyo_Metropolitan/Notebook/A05">5</a></td> ...nter"><a href="https://2011.igem.org/Team:Tokyo_Metropolitan/Notebook/S05">5</a></td>
    14 KB (2,155 words) - 17:17, 4 October 2011
  • Team:KAIST-Korea/Projects/report 12
    {| border="1" cellpadding="5" cellspacing="0" style="width: 75%; height: 100px" border="1" style="margin | k<sub>5</sub>
    16 KB (2,540 words) - 10:47, 11 August 2011
  • Team:Paris Liliane Bettencourt/Notebook/2011/08/11/
    The tubes of 5 and 6, that where identified to be the uncorrect sequence this time are sup 0.5 µg of DNA from the tubes will be digested into:
    4 KB (670 words) - 16:09, 27 August 2011
  • Team:Arizona State/Templates/cas table
    ...49}} || {{:Team:Arizona State/Templates/tigr|02583}} || y || y || rowspan="5"| Regulation {{:Team:Arizona State/Templates/ref|15}} || cas7 | rowspan="5"| cas8a1 || CXXC-CXXC || || y || || || || || || || || || || ||
    12 KB (995 words) - 01:59, 29 September 2011
  • Team:KAIST-Korea/js/fancybox/jquery easing
    ...(x,t,b,c,d){e(t<d/2)6 h.i.A(x,t*2,0,c,d)*.5+b;6 h.i.v(x,t*2-d,0,c,d)*.5+c*.5+b}});',62,74,'||||||return||Math|function|||||if|var|PI|jQuery|easing|pow|7
    7 KB (1,308 words) - 22:43, 11 August 2011
  • Team:KAIST-Korea/Projects/Modeling/Section1
    {| border="1" cellpadding="5" cellspacing="0" style="width: 75%; height: 100px" border="1" style="margin | k<sub>5</sub>
    18 KB (2,705 words) - 16:17, 12 August 2011
  • Team:UNIPV-Pavia/Calendar/July/week3
    <td class="row">2.5</td> <td class="row">2.5</td>
    25 KB (4,110 words) - 15:48, 20 September 2011
  • Team:uOttawa/Results
    ...1 contains the ladder, and the other lanes contain 100 ng of parts 1,2,3,4,5,6 loaded in that order.]] ...ed in one final PCR reaction to obtain the final construct shown in figure 5.
    8 KB (1,324 words) - 06:49, 27 October 2011
  • Team:Peking S/lab/notebook/sr
    |style="text-align:center"| 5 Gel 2 Well 2-5: Marker_rhlI_rhlI_rhlI
    13 KB (1,604 words) - 05:20, 5 October 2011
  • Team:TU Munich/jqueryeasing.js
    if (t==0) return b; if ((t/=d/2)==2) return b+c; if (!p) p=d*(.3*1.5); if (t < 1) return -.5*(a*Math.pow(2,10*(t-=1)) * Math.sin( (t*d-s)*(2*Math.PI)/p )) + b;
    10 KB (1,575 words) - 15:30, 18 August 2011
  • Team:Wageningen UR/Project/ProtocolsProj1
    5 g yeast extract 0.5% (w/v) yeast extract
    6 KB (934 words) - 00:56, 22 September 2011
  • Team:BU Wellesley Software/Wet Lab
    <script src="http://cdn.jquerytools.org/1.2.5/full/jquery.tools.min.js?foo"></script> ...e it shows a more drastic increase, before falling down at the x value of ~5 mM. The huge gap between the last points from the first 3 points allow us t
    37 KB (6,021 words) - 22:52, 28 September 2011
  • Team:UNICAMP-EMSE Brazil/Notebook/22 August 2011
    {|border="1" cellpadding="5" cellspacing="0" align="center" :*Quantification (volume of ladder applied 6 uL; sample: 5 uL DNA +1 uL buffer )
    7 KB (1,126 words) - 20:56, 28 September 2011
  • Team:NTNU Trondheim/scripts/jquery.easing.1.3.js
    if (t==0) return b; if ((t/=d/2)==2) return b+c; if (!p) p=d*(.3*1.5); if (t < 1) return -.5*(a*Math.pow(2,10*(t-=1)) * Math.sin( (t*d-s)*(2*Math.PI)/p )) + b;
    8 KB (1,292 words) - 16:40, 23 August 2011
  • Team:UTP-Panama/Week 9
    5. To this solution were used falcon tubes and sterile water. == August 5==
    5 KB (688 words) - 02:42, 29 September 2011
  • Team:UTP-Panama/Week 15
    5. Supernatant of eppendorf 6 tubes were eliminated<br> 9. It was kept in room temperature during 5 minutes<br>
    3 KB (454 words) - 03:50, 29 September 2011
  • Team:Paris Liliane Bettencourt/Notebook/2011/08/24/
    ...nactivation of EcoRI enzyme was carried on on the PCR tube at 80°C during 5 min. -> 1 µL in 20µL -> daughter solution 5µM
    3 KB (409 words) - 09:21, 2 September 2011
  • Team:Paris Liliane Bettencourt/Notebook/2011/09/21/
    ...nactivation of EcoRI enzyme was carried on on the PCR tube at 80°C during 5 min. -> 1 µL in 20µL -> daughter solution 5µM
    4 KB (582 words) - 04:35, 21 September 2011
  • Team:UNIPV-Pavia/Test
    <li class="toclevel-1"><a href="#t9002"><span class="tocnumber">5</span> <span class="toctext">Characterization of BBa_T9002 biosensor</span> <td class="row">1.5 [26]</td>
    35 KB (4,868 words) - 19:49, 21 September 2011
  • Team:UNICAMP-EMSE Brazil/Notebook/29 August 2011
    :*1,5% {|border="1" cellpadding="5" cellspacing="0" align="center"
    11 KB (1,769 words) - 00:12, 30 August 2011
  • Team:Cambridge/Protocols/Gel Electrophoresis of Protein
    !5% !7.5%
    11 KB (1,855 words) - 20:38, 21 September 2011
  • Team:UANL Mty-Mexico/Templates/Template
    width: 5; <li class="last">Item 5</li>
    11 KB (1,270 words) - 16:21, 1 September 2011
  • Team:UEA-JIC Norwich/pegtransformation
    <p style="color:#000000">5. Filter the protoplast suspension through a 100µm mesh.</p> <p style="color:#000000">6. Spin the filtered suspension at 250g for 5 minutes.Remove the supernatant.
    3 KB (427 words) - 21:09, 21 September 2011
  • Team:WITS-CSIR SA/Project/Characterization
    <img src="https://static.igem.org/mediawiki/2011/5/56/Wits_Logo_Biotweet.gif" alt="Biotweet" height="80px" ...activation at different theophylline concentrations (0 mM, 0.5 mM, 1 mM, 1.5 mM and 2 mM) over a period of time using fluorometry. Competent <i>E. coli<
    36 KB (5,022 words) - 17:19, 6 October 2011
  • MSDS from Promega
    * 5 Firefighting measures (Contd. on page 5)
    13 KB (1,791 words) - 03:52, 3 September 2011
  • Team:DTU-Denmark-2/results/Characterisation
    ...and 245 bp upstream of AN6639 gene, this ensures the targeted integration (5). </p> ...s. The blue color is produced because β-galactosidase cleaves X-gal into 5- bromo-4-chloro-3-indolyl (blue) and D-galactose. Thus, blue colonies means
    15 KB (2,389 words) - 09:07, 4 October 2011
  • Team:WITS-CSIR SA/js/lib/jquery-1.5.1.min.js
    * jQuery JavaScript Library v1.5.1 ...sition="relative",this.subtractsBorderForOverflowNotVisible=f.offsetTop===-5,this.doesNotIncludeMarginInBodyOffset=a.offsetTop!==i,a.removeChild(b),a=b=
    83 KB (15,972 words) - 08:14, 3 September 2011
  • Team:WITS-CSIR SA/Animation/edge includes/jquery.easing.1.3.js
    if (t==0) return b; if ((t/=d/2)==2) return b+c; if (!p) p=d*(.3*1.5); if (t < 1) return -.5*(a*Math.pow(2,10*(t-=1)) * Math.sin( (t*d-s)*(2*Math.PI)/p )) + b;
    8 KB (1,292 words) - 11:43, 3 September 2011
  • Team:DTU-Denmark-2/Project/PlugnplayAssembly/customization
    ... forward and reverse primer linkers are 8-9 bp long, and are placed at the 5’-end of the primers. </dd> <dd>5. Order the primers from your favourite oligo company. Notice that the price
    19 KB (3,014 words) - 20:01, 5 October 2011
  • Team:UNIPV-Pavia/Tecan Measurements
    ...-2011</b> PtetR with RBS30 and RBS31 (E32, E33 induced with 0, 1, 2, 3, 4, 5, 8, 10, 50, 100 ng/ml atc) x 2 ...-2011</b> PtetR with RBS32 and RBS34 (E34, E35 induced with 0, 1, 2, 3, 4, 5, 8, 10, 50, 100 ng/ml atc) x 2
    3 KB (637 words) - 19:18, 16 September 2011
  • Team:TU Munich/project/design
    ...nduces the autophosphorylation at the cytosolic site of cph8[<a href="#r5">5</a>]. This leads to phosphorylation of ompR [<a href="#r6">6</a>] which sub ...hotomorphogenesis: from protein dynamics to physiology. <i>PLoS One</i>, 5(5):e10721, 2010.</p></div>
    9 KB (1,543 words) - 21:59, 28 October 2011
  • Team:ETH Zurich/Biology/MolecularMechanism
    ...nding sites and prefix (5' gaattcgcggccgcttctagag 3') respectively suffix (5' tactagtagcggccgctgcag 3') were added to the gene by polymerase chain react [[File:Table RBS.png|400px|left|thumb|'''Table 5: Different ribosome binding sites and their estimated strengths''' which ar
    10 KB (1,510 words) - 21:25, 28 October 2011
  • Team:ETH Zurich/Biology/Detector
    ...lR hexamerically binds to P<sub>U</sub> promoter and activates it [[#Ref5|[5]]]. This activates expression of the xylene degradation cassette ''xylC-xy [[File:ETH Arac.png|200px|right|thumb|'''Figure 5: Structures of the AraC heterodimere with L-Arabinose''' [[#Ref14|[14]]] ]]
    18 KB (2,725 words) - 02:41, 29 October 2011
  • Team:Washington/Magnetosomes/GibsonVectors
    ===Creation of 5 plasmid vectors=== All togeher, we created 5 pGA vectors and submitted them to the registry:
    5 KB (758 words) - 00:24, 29 September 2011
  • Team:UNIPV-Pavia/Project/Results
    <li class="toclevel-1"><a href="#t9002"><span class="tocnumber">5</span> <span class="toctext">Characterization of BBa_T9002 biosensor</span> <td class="row">1.5 [26]</td>
    37 KB (5,126 words) - 12:50, 22 October 2011
  • Team:Imperial College London/test6
    ...gies that were grown from non-sterile plates had lost fluorescence (Figure 5). <p><i>Figure 5: Colonies recovered from filter discs and grown on LB plates containing sel
    10 KB (1,656 words) - 00:02, 18 October 2011
  • Team:UC Davis/Notebook/Week 13
    <td><a href="https://2011.igem.org/Team:UC_Davis/Notebook/Week_5">5</a></td> ...25 mM, 0.5 mM, and 1 mM. We are instead going to try 0 mM, 1 mM, 2 mM, and 5 mM IPTG. This will allow us to see if the current levels of IPTG are suffic
    8 KB (1,373 words) - 00:32, 29 September 2011
  • Team:WITS-CSIR SA/Accordion/jquery.easing.1.3.js
    if (t==0) return b; if ((t/=d/2)==2) return b+c; if (!p) p=d*(.3*1.5); if (t < 1) return -.5*(a*Math.pow(2,10*(t-=1)) * Math.sin( (t*d-s)*(2*Math.PI)/p )) + b;
    8 KB (1,292 words) - 14:28, 18 September 2011
  • Team:UPO-Sevilla/js/jqueryeasing.js
    if (t==0) return b; if ((t/=d/2)==2) return b+c; if (!p) p=d*(.3*1.5); if (t < 1) return -.5*(a*Math.pow(2,10*(t-=1)) * Math.sin( (t*d-s)*(2*Math.PI)/p )) + b;
    8 KB (1,292 words) - 22:34, 19 September 2011
  • Team:Peking S/lab/protocol/mini
    ...r translucent and mucous-like. The time of lysis will never be longer than 5 min. 6. Add 350ul neutraliza tion buffer (NB) and mix '''gently''' by inverting 5-6 times,
    3 KB (482 words) - 08:36, 2 October 2011
  • Team:USTC-China/Project/modeling
    ...;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;'''Fig. 5'''</p> of the cells grow under the rate of k=0.97*exp(-t/5), the unit
    21 KB (3,249 words) - 10:04, 28 October 2011
  • Team:Glasgow/LOVresults
    <img src="https://static.igem.org/mediawiki/2011/5/59/Screen_shot_2011-09-22_at_01.27.33.png" /></br> <tr><td>LOV2 Forward</td><td>5'-GTGTGTGAATTCGCGGCCGCTTCTAGAGTCGCTGAAGGATCCAAGG-3'</td><td>73</td></tr>
    7 KB (1,224 words) - 05:13, 22 September 2011
  • Team:Potsdam Bioware/Project/Details Microviridin
    ...rified compound yielded a high peak with a retention time of approximately 5 min. Minor peaks could be detected during the following 7 min (Fig. 3). ...grams of the isolated mdnA showed reliable peaks with a retention time of 5 min together with a number of following minor peaks.
    16 KB (2,403 words) - 03:27, 29 October 2011
  • Team:UNAM-Genomics Mexico/Notebook/HydA
    ==Week 5: September 5th-11th== ...ared the primers at the adequate concentration from the stock, they are at 5 μmol/μl.
    3 KB (522 words) - 23:37, 28 September 2011
  • Team:BYU Provo/Team Thermosensor/Week6
    *** 0.5 uL BSA *** 30 uL plasmid(pIG 17-4 and 17-5 each in individual tubes)
    1 KB (227 words) - 06:12, 24 September 2011
  • Team:BYU Provo/Team Thermosensor/Week12
    ===7/5/11=== * Lanes 2, 4, and 5 look great -going to set up overnights. -Mark
    2 KB (403 words) - 08:32, 24 September 2011
  • Team:USC/Notebook/Week12
    [[Team:USC/Notebook/Week5|Week 5]] [[File:week5.jpg|link=Team:USC/Notebook/Week5|Week 5]]
    6 KB (812 words) - 03:58, 29 September 2011
  • Team:NCTU Formosa/modeling
    <div><img src = "https://static.igem.org/mediawiki/2011/5/57/Fig4.jpg" width="700"></div> <br><div><img src = "https://static.igem.org/mediawiki/2011/1/18/P-5.jpg" width="300"></div>
    24 KB (3,693 words) - 15:54, 5 October 2011
  • Team:Brown-Stanford/Lab/Notebook/Week4
    == ''' July 5, 2011''' == *Used four-temp gradient PCR (57.5, 55, 53.2, 51.7 C)
    7 KB (1,015 words) - 18:08, 28 September 2011
  • Team:Calgary/Project/Promoter/Bioinformatics
    ... strains in their registry, <i>putida</i> KT2440 and <i>fluorescens</i> Pf-5, in our search.</p> </html>[[image:Calgary2011_qRT_PCR_List1.jpg|thumb|600px|center|<b>Figure 5. </b>List of genes short-listed for qRT-PCR verification, as queried from D
    28 KB (4,301 words) - 04:02, 29 October 2011
  • Team:Rutgers/Full Adder
    <w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5"/> <w:LsdException Locked="false" Priority="39" Name="toc 5"/>
    33 KB (4,056 words) - 05:09, 27 September 2011
  • Team:Columbia-Cooper/CUNotebook
    <p>Kinase Reaction: use up to 300pmol of 5' termini in 50uL Rxn.</p> <li>Incubate at 25 degrees Celsius for 1.5 hours.</li>
    22 KB (3,881 words) - 13:59, 28 October 2011
  • Team:Peking S/lab/notebook/wdq
    |style="text-align:center"| 5 Electrophoresis PCR reaction system in 1.5% agarose gel.
    18 KB (2,417 words) - 05:07, 5 October 2011
  • Team:Peking S/lab/protocol/competent
    2. Put the tubes on ice to incubate for 5 min. 3. Pellet bacterial cells by 5 min centrifugation at 5000 rpm, discard the supernatant.
    2 KB (262 words) - 09:02, 2 October 2011
  • Team:IIT Madras/Notebook/Protocols/Miniprep using alkaline lysis buffers
    <p>For 5 ml Cultures: 12 – 16 hours incubation. <br/> <li>Pellet down the cells at 12000 rpm for 2 min. Use same eppendorf for 5 ml cultures. Remove all the media from pellet.</li>
    4 KB (664 words) - 12:56, 2 October 2011
  • Team:KIT-Kyoto/Notebook/LabNote/GFPMLF9J
    ...0px" align=center>10 µM GFP Primer F</td><td width="100px" align=right>1.5 µl</td></tr> :<tr><td align=center>10 µM GFP Primer R</td><td align=right>1.5 µl</td></tr>
    14 KB (1,950 words) - 00:21, 6 October 2011
  • Team:NYMU-Taipei/lab-protocols
    ==<font size=5><font color=crimson>'''General'''</font>== #Harvesting: Transfer cultured bacterial cells to a 1.5 ml microcentrifuge tube. Centrifuge at 14-16,000 x g for 1 minute and disca
    13 KB (2,089 words) - 00:25, 29 October 2011
  • Team:Tokyo Tech/Projects/Urea-cooler/construction
    <li><a href="#const2">5. construction of Ptrc-RBS-<i>rocF</i></a></li> ...tI and ligated into pTrc99A backbone vector including trc promoter and RBS(5).
    9 KB (1,313 words) - 14:38, 28 October 2011
  • Team:ArtScienceBangalore/Project
    5. After drying the pellet the DNA should be resuspended in a Tris buffer sol ...ing the DNA present in the soil, mix the soil sample (5 g) in Tris Buffer (5 mL of 25 mM buffer) and mix thoroughly.
    9 KB (1,412 words) - 01:45, 29 October 2011
  • Team:Peking S/lab/notebook/jwy
    |style="text-align:center"| 5 Electrophoresis PCR reaction system in 1.5% agarose gel.
    18 KB (2,417 words) - 05:21, 5 October 2011
  • Team:Tokyo Metropolitan/Notebook/A08
    Add 200μl solution II and upside down 5 times. Add 150μl solution III and upside down 5 times, put on ice for 5 min.
    1 KB (143 words) - 11:30, 5 October 2011
  • Team:Peking S/project/wire/inverter
    ''Figure 5: The genetic construction of the circuit design used for characterization. ...sible promoter was C4-HSL/3OC6-HSL dependent, with strongest repression at 5*10^-4 M of C4-HSL and 10nM of 3OC6-HSL.
    13 KB (1,913 words) - 14:27, 22 November 2011
  • Team:HKU-Hong Kong/Results
    ...rial, sans-serif;color:#000000;margin- top:5px;padding: 2px;" cellspacing="5"; ...rial, sans-serif;color:#000000;margin- top:5px;padding: 2px;" cellspacing="5";
    5 KB (684 words) - 19:29, 5 October 2011
  • Team:OUC-China/Result/week11
    <li><a href="/Team:OUC-China/Result/week5">Week 5</a></li> ...th EcoRI and PstI: raiI、raiR、raiABCpro、18-3-11、14-19、circuit-I、5&4、14-19-13 and carrier C.</p>
    6 KB (955 words) - 02:38, 29 October 2011
  • Team:CBNU-Korea/Methods/Com
    <img src="https://static.igem.org/mediawiki/2011/5/5b/Synb_iDTO_2case.png"><br> <b>5. 1080 species DB</b><br>
    4 KB (615 words) - 21:10, 5 October 2011
  • Team:Grenoble/Projet/Results/Toggle
    ...radient of $1.10^{−6} M$ to $1.10^{−2} M$ and an aTc concentration of $5.10{−6} M$. The X axis represents physical points on the plate, from the r ...strong> Prediction of the switch on the plate for an aTc concentration of $5.10^{−6} M$. Upper panel:
    28 KB (3,850 words) - 03:50, 29 October 2011
  • Team:Peking S/project/nonb/comparator
    (5) The output of the device is either dominated by output 1 or output 2. By s Numerous sRNA/5’UTR pair have been reported in literature. We regarded the ptsG/SgrS pair
    13 KB (2,029 words) - 01:34, 6 October 2011
  • Team:XMU-China/Project/Background
    ...ier-protein] + S-adenosyl-L-methionine = [acyl-carrier-protein] + S-methyl-5'-thioadenosine + an N-acyl-L-homoserine lactone.[8] ...on of lux pR by mutating its DNA sequence. Three mutants, IR-3, IR-5, IR-3/5, were obtained by site-directed mutagenesis using 3-step PCR method.
    11 KB (1,638 words) - 02:18, 29 October 2011
  • Team:Fatih Turkey/test4
    5.       Fentonreagentexperimentwastested.<br> 6.       500 ul FR withdistilledwaterwas put in 1,5 ml Eppendorf; exposedtoheatshock at 50 C hopingthat it wouldreflectblue-gre
    48 KB (6,581 words) - 06:43, 28 October 2011
  • Team:UTP-Panama/After Regional Week 2
    5. Placed between 2.5 to 5 micolitros Ethidium bromide. We mix before pouring it into the camera. <br> 7. 35μL were added ultra-filtered water plasmids were 65.5 ° C.<br>
    4 KB (630 words) - 03:24, 29 October 2011
  • Team:Lethbridge/Project
    ... such as naphthene, anthracene, and fluorene into 2-HMS (Figure 1)<sup>3,4,5</sup>. Catechol 2,3-dioxygenase (xylE) is found in <i>Pseudomonas putida</i ...n of the more toxic organic molecules found in the tailings ponds.<sup>3,4,5,6,10,24</sup>
    28 KB (4,177 words) - 16:21, 12 April 2012
  • Regions/Europe/TravelInfomation
    <LI>Tram 5, direction Amstelveen Binnenhof (25 minutes). Get off at: De Boelelaan/VU the street turn left (to the South). After a 5 minutes walk along a little bushy area you will see
    8 KB (1,421 words) - 18:25, 19 September 2011
  • Team:Arizona State/Project/References
    ... property shared among H-NS-like proteins,” J. Bacteriol., vol. 187, no. 5, pp. 1845-1848, March 2005.</div> ...ersity within a Population of ''Sulfolobus islandicus'',” PloS ONE, vol. 5, no. 9, 28 September 2010.</div>
    16 KB (2,107 words) - 02:44, 29 September 2011
  • Team:Greenfield IN-Schini-HS/Notebook
    ...border=1 bordercolordark="#000000" bordercolorlight="#FFFFFF" cellpadding="5"> <TD vAlign=top align=left width="14%" ><font size="3" face="Verdana">5</font><br><br><br><br></TD>
    21 KB (3,279 words) - 20:30, 14 June 2011
  • Team:WITS-CSIR SA/style.css
    opacity: .5; -webkit-box-shadow: 0 1px 3px rgba(0,0,0,0.5);
    12 KB (1,288 words) - 13:22, 12 July 2011
  • Team:Grenoble/Notebook Rawhide
    <img src="https://static.igem.org/mediawiki/2011/5/56/Marion.png" class="icon"/> <p>Preculture: To perform this new cloning session, we first selected 5 colonies from the Petri dish of MerR-CinR construction.</p>
    15 KB (2,221 words) - 12:43, 8 August 2011
  • Team:TU-Delft/Team/Carsten
    ...oplasm, but periplasm would require use of the same Sec transporter as Mfp-5, possibly fused to TonB for inner membrane integration. ...ll literature had to be available on friday concerning localization of Mfp-5. The focus soon fixed to use of the polar clusters affecting the signaling
    2 KB (322 words) - 07:41, 11 August 2011
  • Team:TU-Delft/Team/Esmee
    ...hese subprojects. I wrote a laboratory manual for characterization of Mgfp-5. Hope to get started in the lab next week! ...n, cell-surface adhesion, and enhancement of the ahesive properties of Mfp-5. In the afternoon we had a meeting with the other three Dutch iGEM teams (A
    5 KB (766 words) - 13:45, 5 July 2011
  • Team:Wageningen UR/Notebook/Proj1/May
    ...ck parts were resuspended from the biobrick source plate in 10 µL dH2O. 1.5 µL of this suspension was used to transform chemically competent ''E. coli ...2 and -K325909. 250 µL SOC medium was added and they were incubated for 1.5 hour at 37°C (300 rpm). 50 µL of these inoculated plates A, 250 µL of th
    5 KB (773 words) - 12:15, 1 September 2011
  • Team:Brown-Stanford/Lab/Notebook
    <td><p>5</p> [[Team:Brown-Stanford/Lab/Notebook/Week4|5]]
    12 KB (1,200 words) - 18:05, 28 September 2011
  • 05/19/11 Agenda:Transformation Test Run
    (4) Incubate on ice 5 minutes. (5) Heat shocked 40 degrees C for 50 seconds
    1 KB (147 words) - 19:55, 2 June 2011
  • Reporter: Week 4 June 6-11
    |5 ml of SOB media with 6 &#956;l of chloramphenicol<br />was innoculated with ===Lac Inducible Test Assembly: Take 4, Day 5===
    10 KB (1,545 words) - 17:24, 13 July 2011
  • Team:Cambridge/CAM JQUERY
    ...gth;h<i;h++)g=e[h].name,g.indexOf("data-")===0&&(g=f.camelCase(g.substring(5)),k(this[0],g,d[g]))}}return d}if(typeof a=="object")return this.each(funct ...[1]=a[1].replace(i,"");!f&&l.attrMap[g]&&(a[1]=l.attrMap[g]),a[4]=(a[4]||a[5]||"").replace(i,""),a[2]==="~="&&(a[4]=" "+a[4]+" ");return a},PSEUDO:funct
    89 KB (17,186 words) - 11:09, 20 July 2011
  • Team:UEA-JIC Norwich/Safety
    ...ted with the use of our model organisms. The Escherichia coli strains (NEB 5-alpha Competent E. coli) (1) and Agilent XL10-Gold Ultracompetent Cells (2) The JIC operates under the standard biosafety rules of the UK (5)
    7 KB (1,167 words) - 06:35, 22 September 2011
  • Team:UC Davis/Notebook wip
    |LacI 5 || 109.35 ||1.22 == Week 5 ==
    15 KB (2,467 words) - 19:25, 18 July 2011
  • Team:KAIST/jquery
    ...gth;h<i;h++)g=e[h].name,g.indexOf("data-")===0&&(g=f.camelCase(g.substring(5)),k(this[0],g,d[g]))}}return d}if(typeof a=="object")return this.each(funct ...[1]=a[1].replace(i,"");!f&&l.attrMap[g]&&(a[1]=l.attrMap[g]),a[4]=(a[4]||a[5]||"").replace(i,""),a[2]==="~="&&(a[4]=" "+a[4]+" ");return a},PSEUDO:funct
    89 KB (17,090 words) - 16:31, 27 June 2011

View (previous 500 | next 500) (20 | 50 | 100 | 250 | 500)

Retrieved from "http://2011.igem.org/Special:Search"