"
Team:KIT-Kyoto/Notebook/LabNote/DIAP2-MALT9
From 2011.igem.org
 |
|
| Home | Team | Project | Parts | Notebook | Safety | Human Practice | Attributions |
|---|
| Home > Notebook > Lab Note > September | Language：English/Japanese |
|---|
1st, September
Member
- Takeda
- Again different annealing conditions were tested.
PCR reaction 10 µM Primer F 1.5 µl 10 µM Primer R 1.5 µl Template DNA 1 µl 10 x PCR Buffer 5 µl dNTPs 5 µl MgSO4 2 µl or 4 µl ddH2O 33 µl or 31 µl KOD+ polymelase 1 µl total 50 µl Cycle Pre-Denature 94°C 2min Denature 94°C 15sec 35 Cyle Anneling 50.5°C 30sec Extension 68°C 100sec End 4°C keep
- PCR products were applied to the agarose gel electrophoresis.
Results
- Image of the agarose gel.
-
Lane 1；DNA size marker（1 Kbp ladder）
Lanes 2；DIAP2 cDNA
Amplified DNA fragments were barely detectable for the DIAP2.
5th, September
Member
- Yokoigawa, Takeda
- The PCR products for DIAP2 was treated wit phenol-chloroform and then digested with the XhoI for 20 hours at 37°C.
DIAP2 PCR reaction in ddH2O 44 μl 10 x H Buffer 5 μl XhoⅠ 1 μl total 50 μl
6th, September
Member
- Yokoigawa, Takeda
- The PCR products for DIAP2 was treated wit phenol-chloroform and then digested with the XbaI for 20 hours at 37°C.
DIAP2 PCR reaction in ddH2O 44 μl 10 x M Buffer 5 μl XbaⅠ 1 μl total 50 μl
7th, September
Member
- Yokoigawa, Takeda
- The restriction enzyme-digested PCR fragments and pUAST-flag DNA were extracted from the agarose gel by QIAquick Gel Extraction Kit.
Results
- PCR products for DIAP2 was not successfully recovered from the agarose gel.
12nd, September
Member
- Matsunami, Yokoigawa
- To amplify DIAP2 cDNA, PCR reactions were carried out by using the following primers and under the following conditions.
- F primer GCTTCTCGATTGACGGAGCTGGGCATGGAGCT
- Tm value 62 °C
- R primer GCCGTCTAGATCACGAAAGGAACGTGCGCA
- Tm value 66.4°C
- amplicon size 1514 bp
PCR reaction 10 µM Primer F 1.5 µl 10 µM Primer R 1.5 µl Template DNA 1 µl 10 x PCR Buffer 5 µl dNTPs 5 µl MgSO4 2 µl ddH2O 33 µl KOD+ polymelase 1 µl total 50 µl Cycle Pre-Denature 94°C 2min Denature 94°C 15sec 35 Cycle Anneling 50.5°C 30sec Extension 68°C 1min40sec End 4°C keep
- Again different annealing conditions were tested.
- Annealing 50.5°C
13rd, September
Member
- Matsunami, Yokoigawa
- PCR products on 12th September were applied to the agarose gel electrophoresis.
Results
- Image of the agarose gel.
-
- Lane 1；DNA size marker（1 Kbp ladder）
- Lanes 2 and 3；DIAP2 cDNA
- Amplified DNA fragments were barely detectable for the DIAP2.
14th, September
Members
- Matsunami,Yokoigawa
- To amplify API2-MALT1 cDNA and, PCR reactions were carried out by using the following primers and under the following conditions.
- F primer GCCGCTCGAGACATAGTAGAAAACAGCAT
- Tm value 57.7 °C
- R primer GCCGGCTAGCTCATTTTTCAGAAATTCTGA
- Tm value 56.5 °C
- amplicon size 3131 bp
PCR reaction 10 µM Primer F 0.4 µl 10 µM Primer R 0.4 µl Template DNA 1 µl 10 x Ex Taq Buffer 2 µl Takara Ex Taq 0.1 µl 2.0 mM dNTPs 2 µl ddH2O 14.1 µl total 20 µl Cycle Pre-Denature 94°C 2min Denature 94°C 30sec 37 Cycle Anneling 51.5°C 30sec Extension 72°C 3min20sec +Extension 72°C 10min End 4°C keep
- PCR products were applied to the agarose gel electrophoresis.
Results
- Image of the agarose gel.
-
- Lane 1；DNA size marker（1 Kbp ladder）
- Lanes 2 and 3；API2-MALT1 cDNA
- No PCR product was detected for API2-MALT1.
15th, September
Members
- Matsunami,Yokoigawa
- To amplify API2-MALT1 cDNA and DIAP2 cDNA, PCR reactions were carried out by using under the following conditions.
- API2-MALT1
PCR reaction 10 µM Primer F 0.4 µl 10 µM Primer R 0.4 µl Template DNA 1 µl 10 x Ex Taq Buffer 2 µl Takara Ex Taq 0.1 µl 2.0 mM dNTPs 2 µl ddH2O 14.1 µl total 20 µl Cycle Pre-Denature 94°C 2min Denature 94°C 30sec 37 Cycle Anneling 53°C 30sec Extension 72°C 3min20sec +Extension 72°C 10min End 4°C keep
- DIAP2
PCR reaction 10 µM Primer F 1.5 µl 10 µM Primer R 1.5 µl Template DNA 1 µl 10 x PCR Buffer for KOD Plus 5 µl dNTPs 5 µl MgSO4 2 µl ddH2O 33 µl KOD Plus 1 µl total 50 µl Cycle Pre-Denature 94°C 2min Denature 94°C 15sec 35 Cycle Anneling 50.5°C 30sec Extension 68°C 1min 40sec End 4°C keep
- PCR products were applied to the agarose gel electrophoresis.
- The PCR products for DIAP2 was treated with phenol-chloroform and then digested with the XhoI for 20 hours at 37°C.
DIAP2 PCR products in ddH2O 44 µl 10 x H Buffer 5 µl XhoⅠ 1 µl total 50 µl
Results
- Image of the agarose gel.
-
- Lane 1；DNA size marker（1 Kbp ladder）
- Lanes 2~5；DIAP2 cDNA
- Lane 6~8；API2-MALT1 cDNA
- Amplified DNA fragments were barely detectable for the DIAP2.
- Size of the amplified fragments for API2-MALT1 was different from the expected size
16th, September
Members
- Matsunami,Yokoigawa
- The PCR products for DIAP2 was treated with phenol-chloroform and then digested with the XbaI for 20 hours at 37°C.
DIAP2 PCR products in ddH2O 44 µl 10 x M Buffer 5 µl XbaⅠ 1 µl total 50 µl
17th, September
Members
- Matsunami,Yokoigawa
- The restriction enzyme-digested PCR fragments were extracted from the agarose gel by Gel Extraction Kit.
Results
- Image of agarose gel.
-
- PCR products for DIAP2 was not successfully recovered from the agarose gel.
18th, September
Member
- Matsunami
- I have streaked E.coli DH5 alpha on LB plate and incubated for 16h.
19th, September
Member
- Matsunami
- I have picked a single colony up, transferred it into 250 ml of SOB medium in a flask.
- I have incubated it at 18°C with shaking.
21st, September
Member
- Matsunami
- 1.SOB medium in a flask was quantified by measuring the absorbance at OD600.
- 2. I have repeated the PCR reactions to amplify DIAP2 cDNA under the same conditions as those carried out on 12th September.
PCR reaction 10 µM Primer F 1.5 µl 10 µM Primer R 1.5 µl Template DNA 1 µl 10 x PCR Buffer 5 µl dNTPs 5 µl MgSO4 2 µl ddH2O 33 µl KOD+ polymelase 1 µl total 50 µl Cycle Pre-Denature 94°C 2min Denature 94°C 15sec 35 Cycle Anneling 50.5°C 30sec Extension 68°C 1kb/min End 4°C keep
- Amplified DNA fragments were detectable for the DIAP2.
- The PCR products for DIAP2 was treated with phenol-chloroform and then digested with the XhoI for 20 hours at 37°C.
| DIAP2 |
| PCR products in ddH2O | 44 µl |
| 10 x H Buffer | 5 µl |
| XhoⅠ | 1 µl |
| total 50 µl |
Results
- 1. The absorbance OD600 was over at 0.9.
- 2.Image of agarose gel.
-
- Lane 1；DNA size marker（1 Kbp ladder）
- Lanes 2~7；DIAP2 cDNA
- The PCR products with the expected size (1.5 kb) were detected for DIAP2.
22nd, September
Member
- Matsunami
- The PCR products for DIAP2 was treated with phenol-chloroform and then digested with the XbaI for 20 hours at 37°C.
DIAP2 PCR products in ddH2O 44 µl 10 x M Buffer 5 µl XbaⅠ 1 µl total 50 µl
23rd, September
Member
- Matsunami
- The restriction enzyme-digested PCR fragments were extracted from the agarose gel by Gel Extraction Kit.
Results
- Image of agarose gel.
-
- PCR products for DIAP2 was not successfully recovered from the agarose gel.
25th, September
Member
- Matsunami
- I have picked a single colony up, transferred it into 250 ml of SOB medium in a flask.
- I have incubated it at 18°C with shaking.
27th, September
Member
- Matsunami
- I have made competent cell DH5 alpha.
Results
- Competency was very low.
