Team:UC Davis/Data LacI
From 2011.igem.org
Start a Family
Got a favorite BioBrick? Check our our process for expanding basic parts into part families.Criteria
View our judging criteria for iGEM 2011 here.
LacI Promoter Characterization Data
Wild-type
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.99353, 0.78661, 0.61233, 0.48347, 0.40302, 0.31833, 0.17311 0.0031579, 0.0052541, 0.0059555, 0.0069092, 0.0041919, 0.0052347, 0.0024241 4 0, 1, 2.5, 5 0.00000, 0.0014, 0.0028, 0.0042, 0.0056, .0070, .0140 0.99353, 1.02920, 1.05770, 1.12136, 0.78661, 1.00142, 1.02352, 1.06377, 0.61233, 0.90829, 0.95385, 1.06676, 0.48347, 0.77363, 0.85365, 0.99591, 0.40302, 0.67853, 0.74660, 0.93119, 0.31833, 0.56058, 0.62386, 0.83851, 0.17311, 0.33178, 0.40330, 0.58631 0.0031579, 0.0078785, 0.0087252, 0.0491108, 0.0052541, 0.0065114, 0.0028587, 0.0289843, 0.0059555, 0.0047101, 0.0029583, 0.0241440, 0.0069092, 0.0036622, 0.0052977, 0.0270465, 0.0041919, 0.0042828, 0.0210219, 0.0054843, 0.0052347, 0.0067734, 0.0282990, 0.0027105, 0.0024241, 0.0038951, 0.0043371, 0.0029370Mutant 1
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.84293, 0.52501, 0.28185, 0.14559, 0.082367, 0.05077, 0.017707 .017132, .016563, .010138, .0083723, .0036696, .0013295, .00029933 0, 1, 2.5, 5 0.00000, 0.0014, 0.0028, 0.0042, 0.0056, .0070, .0140 0.84293, 0.87306, 0.88569, 0.88705, 0.52501, 0.73231, 0.85955, 0.86384, 0.28185, 0.49594, 0.754, 0.85027, 0.14559, 0.30866, 0.53435, 0.79143, 0.082367, 0.20109, 0.38603, 0.6632, 0.05077, 0.13482, 0.28296, 0.59708, 0.017707, 0.062278, 0.080463, 0.22066 0.017132, 0.017727, 0.020661, 0.014524, 0.016563, 0.0095391, 0.013332, 0.024361, 0.010138, 0.017069, 0.017257, 0.019877, 0.0083723, 0.0064858, 0.006745, 0.035387, 0.0036696, 0.0024604, 0.014455, 0.017886, 0.0013295, 0.0017976, 0.0039159, 0.011506, 0.00029933, 0.0014914, 0.00096534, 0.0054255Mutant 2
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattattgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacgca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.66043, 0.44899, 0.27847, 0.19007, 0.14271, 0.11669, 0.061421 .018716, .015384, .0098251, .011268, .0061044, .0030215, .0008294 0, 1, 2.5, 5 0.00000, 0.0014, 0.0028, 0.0042, 0.0056, .0070, .0140 0.66043, 0.72139, 0.72156, 0.68292, 0.44899, 0.6366, 0.71926, 0.69494, 0.27847, 0.45878, 0.63883, 0.68131, 0.19007, 0.33367, 0.48602, 0.61718, 0.14271, 0.2557, 0.3774, 0.53217, 0.11669, 0.19954, 0.29437, 0.4718, 0.061421, 0.096767, 0.1356, 0.25018 0.018716, 0.012137, 0.012946, 0.017598, 0.015384, 0.012073, 0.011769, 0.010884, 0.0098251, 0.014087, 0.005962, 0.016007, 0.011268, 0.010077, 0.0063601, 0.032621, 0.0061044, 0.010882, 0.0061672, 0.029959, 0.0030215, 0.0073785, 0.00397, 0.01491, 0.0008294, 0.0070557, 0.0015888, 0.0026091Mutant 3
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaaagtgagttagctcactcattaggcaccccaggctttacactttaagcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.63328, 0.35345, 0.1976, 0.1104, 0.065516, 0.042821, 0.014963 .033565, .014178, .0098194, .011065, .0057402, .0026293, .00076312 0, 1, 2.5, 5 0.00000, 0.0014, 0.0028, 0.0042, 0.0056, .0070, .0140 0.63328, 0.69271, 0.71026, 0.75696, 0.35345, 0.51328, 0.67568, 0.7587, 0.1976, 0.3267, 0.50067, 0.70773, 0.1104, 0.20677, 0.33992, 0.52743, 0.065516, 0.13261, 0.23971, 0.41148, 0.042821, 0.085832, 0.16709, 0.35498, 0.014963, 0.022957, 0.035527, 0.12963 0.033565, 0.036371, 0.039807, 0.021793, 0.014178, 0.0060065, 0.023267, 0.019054, 0.0098194, 0.0058528, 0.0066284, 0.015857, 0.011065, 0.0034758, 0.0039971, 0.064364, 0.0057402, 0.0017609, 0.0055395, 0.040444, 0.0026293, 0.0013106, 0.0046305, 0.012042, 0.00076312, 0.00032783, 0.00066923, 0.0016036Mutant 4
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgcgcgcaacgcaactaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacgca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.31767, 0.17005, 0.10219, 0.063898, 0.045055, 0.034767, 0.017343 .010988, .0044378, .0031212, .004087, .0025152, .00043641, .00020276 0, 1, 2.5, 5 0.00000, 0.0014, 0.0028, 0.0042, 0.0056, .0070, .0140 0.31767, 0.34757, 0.3608, 0.34776, 0.17005, 0.25419, 0.33186, 0.33032, 0.10219, 0.17489, 0.26515, 0.31199, 0.063898, 0.1182, 0.19703, 0.26871, 0.045055, 0.082478, 0.14751, 0.21937, 0.034767, 0.060288, 0.10815, 0.18865, 0.017343, 0.023308, 0.030312, 0.080942 0.010988, 0.010027, 0.012595, 0.013208, 0.0044378, 0.0050367, 0.007641, 0.0075742, 0.0031212, 0.005471, 0.0023857, 0.0096344, 0.004087, 0.0019016, 0.006205, 0.020668, 0.0025152, 0.0020285, 0.0039214, 0.012822, 0.00043641, 0.00055117, 0.0010622, 0.003141, 0.00020276, 0.00023033, 0.0010985, 0.0010405Mutant 5
caatacgcaaaccgcctctccccgcgcgtcggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctccctcatcaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.76419, 0.45666, 0.25652, 0.16829, 0.11854, 0.093686, 0.054054 .032442, .013252, .012617, .0085441, .005527, .0017459, .00062193 0, 1, 2.5, 5 0.00000, 0.0014, 0.0028, 0.0042, 0.0056, .0070, .0140 0.76419, 0.80169, 0.82451, 0.85141, 0.45666, 0.68378, 0.8154, 0.86986, 0.25652, 0.43459, 0.66544, 0.83262, 0.16829, 0.29358, 0.48126, 0.69943, 0.11854, 0.20404, 0.34253, 0.59125, 0.093686, 0.14943, 0.25307, 0.51915, 0.054054, 0.067506, 0.085897, 0.21106 0.032442, 0.043917, 0.042233, 0.0095133, 0.013252, 0.0084313, 0.023269, 0.01513, 0.012617, 0.0056627, 0.0086734, 0.017897, 0.0085441, 0.003882, 0.0078432, 0.052522, 0.005527, 0.0025057, 0.0039495, 0.039797, 0.0017459, 0.0017848, 0.0035247, 0.011518, 0.00062193, 0.0012843, 0.0010686, 0.002401Mutant 6
caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctctacactttatgcttccggcttgtatgttgtgtggaattgtgagcggataacaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.55751, 0.39467, 0.26512, 0.17411, 0.12033, 0.086001, 0.036371 .0075946, .005595, .0042456, .00568, .0048842, .002313, .00049314 0, 1, 2.5, 5 0.00000, 0.0014, 0.0028, 0.0042, 0.0056, .0070, .0140 0.55751, 0.56255, 0.56785, 0.58454, 0.39467, 0.4926, 0.56662, 0.562, 0.26512, 0.37128, 0.50313, 0.57582, 0.17411, 0.27137, 0.39351, 0.53095, 0.12033, 0.20031, 0.30487, 0.46169, 0.086001, 0.14549, 0.23471, 0.39465, 0.036371, 0.058668, 0.095081, 0.21265 0.0075946, 0.017581, 0.014201, 0.005585, 0.005595, 0.0047018, 0.012246, 0.022603, 0.0042456, 0.0035865, 0.0081421, 0.0054892, 0.00568, 0.0027604, 0.0041534, 0.013642, 0.0048842, 0.0017498, 0.0031374, 0.016814, 0.002313, 0.0013403, 0.0029052, 0.003605, 0.00049314, 0.00084767, 0.00089771, 0.0015101Mutant 7
caatacgcaaaccgcctctccccgcgcgttggccgattcattagtgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgtagtgtggaattgtgagcggatatcaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.85845, 0.62076, 0.43628, 0.30625, 0.24044, 0.19269, 0.10768 .0.0224439, 0.0111706, 0.0095075, 0.0129382, 0.0093905, 0.0026913, 0.0024300 0, 1, 2.5, 5 0.00000, 0.0014, 0.0028, 0.0042, 0.0056, .0070, .0140 0.85845, 0.90713, 0.94177, 0.95054, 0.62076, 0.83675, 0.93042, 0.92862, 0.43628, 0.67716, 0.87094, 0.94269, 0.30625, 0.51206, 0.77736, 0.88470, 0.24044, 0.40324, 0.60534, 0.82591, 0.19269, 0.31550, 0.49199, 0.78601, 0.10768, 0.17867, 0.24798, 0.50439 0.0224439, 0.0223095, 0.0293059, 0.0159658, 0.0111706, 0.0105817, 0.0186839, 0.0148995, 0.0095075, 0.0107458, 0.0224771, 0.0174710, 0.0129382, 0.0081189, 0.0091454, 0.0513437, 0.0093905, 0.0053745, 0.0250836, 0.0373250, 0.0026913, 0.0038961, 0.0073887, 0.0121860, 0.0024300, 0.0021880, 0.0027920, 0.0059692
This widget displays the GFP fluorescence data we have collected for our seven LacI promoter mutants as well as the wild-type promoter using the constructs listed on the LacI project page. Repressor transcription is initiated by induction with arabinose, while IPTG binds and reduces repressor activity, thereby increasing promotion of GFP.
You may select any combination of mutants to display simultaneously by toggling them on or off with the buttons on the right side. This allows you to easily view the strength of a mutant of interest in comparison to wildtype or other mutants.
Thanks to our new KO3D library, you may also view characterization data for all variants in resonse to IPTG and arabinose by selecting the '3D Plot' button. This will present you with a graph of the relative fluorescence for the promoter of interest plotted at varying IPTG and arabinose levels. You can click drag the 3D plot with your mouse to view the data from different angles.
Please note that error bars are displayed for both 2D and 3D data by single lines originating from sampled points, even though these lines are not easily visible at all sampling conditions. 3D data has been interpolated for colormapping, but the shape of the curve has not been smoothed and sampled points are clearly marked by intersecting lines. All of the mutant sequences and corresponding Parts Registry pages can be found here.
Thanks to our new KO3D library, you may also view characterization data for all variants in resonse to IPTG and arabinose by selecting the '3D Plot' button. This will present you with a graph of the relative fluorescence for the promoter of interest plotted at varying IPTG and arabinose levels. You can click drag the 3D plot with your mouse to view the data from different angles.
Please note that error bars are displayed for both 2D and 3D data by single lines originating from sampled points, even though these lines are not easily visible at all sampling conditions. 3D data has been interpolated for colormapping, but the shape of the curve has not been smoothed and sampled points are clearly marked by intersecting lines. All of the mutant sequences and corresponding Parts Registry pages can be found here.
Initial Analysis
Our mutants show a range in both basal promoter activity and repressor sensitivity. Viewing the 3D plots of several mutants (such as #3 and #6) reveals areas where the surfaces cross -- this could indicate that mutant #3 has greater unrepressed promoter activity but more sensitive to repressor, causing it to dip below the activity of #6 under conditions of greater repressor expression.This data could be improved by assaying at higher arabinose induction levels, especially for wild type, for which it appears that arabinose induction at .014 percent by weight is not enough to maximize repressor expression.
Modeling
The genetic construct used to characterize our parts is constructed as follows:
Essentially, constitutively-expressed AraC on the genome of our strain (BW22826) regulates the expression of the pBAD promoter. L-Arabinose can bind to AraC, derepressing pBAD and upregulating the amount of LacI repressor present. LacI then represses our mutant (or wildtype) promoter, with IPTG acting as an inducer. The entire construct can be modeled with the following set of equations:

For a more complete description of the parameters, click here.
We fit these parameters to our wild-type characterization data, and got the following results:

Very soon, we hope to get parameter values for mutants. Stay tuned!
"




