Team:Brown-Stanford/Lab/Notebook/Week9

August 8, 2011

PowerCell

• streaked secret pRL623 (YUSSS! YUUUSSSS!!!)
• flipped nitrocellulose transfer filter so conjugates are facing the plate on two of the transformations. Not sure if this is necessary, but might as well see. I think it’ll bring the cyanos into greater contact with antibiotics.
• Semi-finalized synthetic construct sequence.
• ran PCR of Anabaena and Nostoc promoters, cscB and GFP with biobrick additions.
• gel of Anabaena and Nostoc promoters: YUSSS! YUUUUUUSSSSSS!!!!
• gel of cscB and GFP: GFP YUSS!!!!!!, cscB eh...
• this was an awesome day.
• Double digested gibson minipreps with E and S
• ran on gel

REGOBricks

Made SSMP + BSA (used up all 2xSSM)

FRETSensor

• 63 LB/amp plates made
• 3 dockerin constructs transformed into E. coli top10, gel stab of cohesin-cohesin spread onto two new plates
• UV trials: 0s, 2s, 4s, 6s, 8s, 10s, 30s, plated in 1x, 10x, 100x, 1000x dilutions on plates in quarters

August 9, 2011

PowerCell

• pick pRL623 colony to liquid culture along with fresh liquid cultures of pRL25, pRL443, pRL1383a, RP1. (afternoon)
• Qiagen gel extracted bands from yesterday’s gels containing our BIOBRICKS (GFPmut3b, Ana prom, Nos prom).
• Nanodrop readings: GFP: 30; Nos: 6; Ana: 11; however, spectra were suspicious and 260/280 ratios were >2.5
• Kosuke volunteered to run our gel xt products on another gel to verify that we still had DNA- can visualize single bands on Kosuke’s gel, correct length; w00t!
• Double digested Ana and Nos prom, GFP mut3b, pSB1C3 backbone
• Buffer 3 used; EcoRI and PstI;
• 10ul of Ana, Nos, and GFP used to make 55ul rxn (although buffer was added only for a 50ul rxn); used 15ul in 50ul rxn for pSB1C3
• Ligation of Ana, Nos, and GFP mut3b into respective backbones
• used 1.5ul of digest backbone (which is at ~7.5n/u)
• added digested inserts (6:1 ratio for Ana and GFP, 3:1 ratio for Nos; on account of feasible concentrations
• ~25ul ligation rxn, with 1ul of T4 ligase and using 2x buffer
• in 22.5C for 30min, then heatkill ligase at 65C for 10min
• transformed 10ul of ligation product into TOP10 (30min incubate on ice, 30min recovery time)

• Rerun our 8/8 PCR products (GFP, Ana, Nos) on gel to reattempt gel xt, get more products for further digest and ligation attempts
• Ana and Nos successful, gels cut (not yet extracted); GFP gel failed...?
• cscB biobrick PCR attempt 2 - 2 ul of template this time, 0.75ul DMSO, and eight temps from 40 to 60. Modifications to cycler program as well. Nothing. Hmm.
• is there a single base mismatch between the reverse primer and the template?
• CTTTTTCCGGTTGTTGTCGATAGC (from E. coli W) vs. GATATCGACAACAACCGGAAAAAG which is reverse complemented into CTTTTTCCGGTTGTTGTCGATATC
• PCR product run again on 0.8% gel with 1kb ladder, just to get a better look at what could have been a band.
• these annealing regions have been used successfully in the past!!!!
• PCR re-attempted with phusion. No bands at correct size until 55?, which had bands at ~750 and at correct size, ~1.2kb.
• Checked sequences we got from Elim for the Gibson pieces. They actually line up to the expected very well. There is hope yet for gibson.
• Tomorrow: PCR construct out of Gibson minipreps using VF2, VR, check for length

REGOBricks

• Urease Activity Using Conductivity: Tested 4 Cultures:

1. Mysterious Culture (looks like S. past) found in the incubator
2. Refrigerated aliquot of S. past, stored at 4 C for three days
3. Dosier's S. pasteurii- from dried plate
4. Dosier's S. pasteurii- from okay plate

• From the assay, #2- refrigerated aliquot of S. past had the highest Specific Urease Activity: 0.055187638 mS/min/OD. Using appoximation:
• An increase of 1mS in the urease solution is equivalent to the hydrolysis of 10mM urea, urea

• Looking at the graph, it seems that our values run the gamut from highest urease activity to lowest.

FRETSensor

• RFP E. coli W on BG11 sucrose plates show a few colonies. None below 10 mM, except one colony on a 5mM plate. Not confirmed if E. coli W. (there was yellow contamination on one plate)
• UV trials: showed growth curve, decreasing with increased exposure. No growth past 2s.
• UV trials: 0s, 1s, 2s, 3s, 4s
• Constructs grown up in LB/amp liquid cultures, ready for his-column tomorrow

August 10, 2011

• checked on transformants of our biobrick plasmids (nothing, but POSSIBLY USED pSB1A2 backbone to ligate? thus plated some of day-old transformants on LB Amp to check)
• To test whether our large Nostoc liquid cultures are contaminated, we innoculated 10ul of each into 1ml of fresh LB (Thomas says if there is contamination, they will turn up cloudy in a day)
• Performed phusion PCR on pSB1C3 from the registry to get more linearized backbone
• images turned up great, cut out gels to extract; run the rest of rxn with Evan’s gel
• all three bands were clear, cut
• Qiagen gel extracted the pSB1C3 gel bands
• (forgot to perform isopropanol step, but shouldn’t affect products between 500-4kb) Nanodrop readings: 15.5ng/ul, and 28ng/ul
• Performed Eco/Pst digest of pSB1C3
• used 50ul rxn from Silver lab protocol;
• 5ul of 10x Buffer 3 | 0.5ul 100x BSA | 0.3ul EcoRI | 0.3ul PstI | all ~27ul of gel extract (at 15.5ng/ul) | 16.9ul H2O
• expected concentration of digest = 8.37ng/ul
• PCR Ana and Nos Phet using newly arrived Elim primers (1:30 ext times- this is probably too long)
• Transformation
• test transformation with pRL443, pRL623, pRL25, prl1383a into anabaena.
• nine dilutions of Anabaena used in a grid, labeled on lid with registration marks on edge.
• Set up cross of pRL25xpRL625 in regular LB
• ramp up neomycin on selective plates? Check previous transformations.
• PCR
• cscB pcr: temperatures around 55? other factors? probably a gel extraction will be necessary. Run a lot of DNA on the gel. Also, use a new gel. That old one is getting all crapped up.
• re-design primer

REGOBricks

• Re-suspension tests

1. Test conductivity of s. pasteurii straight from culture for 5 min recording every 30s
2. Test conductivity of s. pasteurii re-suspended in BANG, Dosier, and urea broth for 5 min recording every 30s

• Repeat after 1 and 2 hours

• Conductivity w/ e.coli
  • spin

August 11, 2011

PowerCell

• image Ana and Nos pHet PCR products (kept in 4C)
• Performed qiagen PCR cleanup on digested pSB1C3 from 8/10 (Nanodrop reading 6.3n/u)
• not left with much DNA, need to secondary PCR at high volume to produce more for future trials
• Ligation, transform: ana promoter, nos promoter, GFP
• ligation performed based on 50 ng of vector DNA (pSB1C3) , 2:1 insert/vector ratio, 10min at room temp, no heat inactivation before storage at -20C
• ? of ligation product used to transform
• ordered more ligase & buffer! (hopefully)
• second-round PCR test run on backbone gel xt from 8/10 (used Platinum super mix, 1ul of template, 45-55C)
• if successful, performing bulk secondary PCR on 8/12 for use in future digestion/ligation/transformations
• transformation
• innoculate (microwaved!) kan/chlor plate with cross result and return to incubator.
• second transformation done as plate transformation with only 1 and 1/10 dilutions of anabaena used. prl25/623/443 used.
• next phase of transformation- one replicate of 8/10 transformation transferred to neo50
• liquid culture of E. coli W stuck in liquid LB for later dna prep and PCR of cscB.
• Ran the gel for Gibson Miniprep and cscB. Twice due to unsureness. Gibson miniprep looks like its probably contamination :(.
• Prepared cyanos for balloon flight. They are now ready to go!
• Sent the construct off for synthesis. Well, sent the construct to Lynn and Mike, who will need to order it.
• Innoculated 2 more 100ml Nostoc liquid cultures to grow up.

REGOBricks

• To Do:
• Check culture tubes of electroporation bang kan s. pasteurii in the white tub in the 37C shaker
  • If growing then transformation worked! (maybe...) (the plate of this stuff is in the 30C)
• Column stuff
• Protoplast transformation
• PCR (protocol below)
• Run Gel

• PCR protocol
  • Create a new program with either of the thermocyclers

1. Denature @ 98C for 5min
   1. This pops the cells
2. Denature @ 98C for 10 seconds
   1. This separates the double strands of DNA
3. Anneal @ Primer annealing temperature (might be good to do a gradient on this first try)
   1. This allows the primers to anneal to the single stranded template DNA
4. Extension @ 72C for 4 min (15-30s per kb)
   1. Polymerase polymerizes the DNA
5. Repeat steps 2-4 32 times
   1. Make lots of DNA
6. Elongation @72C for 10 min
   1. lets the polymerase finish off anything that it missed
7. Hold @ 4C forever

• Get an ice bucket and put all of these items on ice (can find in powercell box).
• LEAVE PHUSION IN -20C UNTIL YOU ABSOLUTELY NEED IT

• Combine these ingredients in this order:

• If running a gradient of 6 different temps just multiply everything x6

• Miniprep of pBU11- yield: tube 1: 204.6 ng/ul. Tube 2: 220.3 ng/ul.
• PCR gradient 45-55 C

• Preparation: Add, in following order
• 11.8 ul of nuclease free H20
• 4 uL 5x Phusion buffer
• 0.4 ul dNTP
• 1 ul of each primer
• 1 ul of template
• 0.6 ul DMSO

• Go take Phusion out of fridge, add 0.2 ul Phusion
• PCR trials here: https://docs.google.com/a/brown.edu/spreadsheet/ccc?key=0AkZCMwuNOEIHdE1JQkt4ZF82UFo1SGswMWIxakZuanc&hl=en_US#gid=0

August 12, 2011

PowerCell

• Ligation transformants did not yield any colonies :(
• Ran diagnostic gel on our entire ligation process:
• 2ndary PCR of our pSB1C3; our primary pSB1C3 product in gel xt form, our digested pSB1C3, and ANG lig products
• There was serious smearing and smileys in our 2ndary PCR and primary PCR products (we only loaded 3ul); the digested primary pSB1C3 and gel xt primary pSB1C3 were similar except for smileys;
• ANG lig products showed very clear and regular stepwise bands; concatemer formation??
• performed another transformation of the ligation products
• used the remaining ligation product from each
• used 50 μl of cells
• same incubation time (1 hr), but in the cycling oven rather than the incubator
• Ran 60ul phusion biobrick PCR of CscB (using old and new primers, cscB plasmid or E coli W as template), Ana, Nos, and GFP
• see conditions in PCR lab notebook
• imaged: ran out 10ul of each, 50ul of PCR product remaining; CscB with new primers and plasmid template (“CN”)worked very well, as did Anabaena; faint band seen for Nos, none for GFP; Ana and CscB bands cut out and kept in 4C
• Sent in Gibson miniprep fro sequencing
• Imaged the remaining product of our pSB1C3 secondary PCR (from 8/11), excised bands and gel extracted
• Nanodrop: 16ng/ul with ~43ul, currently in 4C
• transfer both replicates of 8/11 transformation, the second replicate of the 8/10 transformation to neo50
• Transformation
• Attempted transformation of pRL25 into pRL623 following CT4 calcium chloride competency protocol.
• new liquid cultures of 623 for competency.

August 13, 2011

PowerCell

• Ran the remaining CN, Ana on gel, excise, and extract along with bands cut from 8/12
• Nanodrop readings: CscB (40ng/ul), Ana (35ng/ul)
• Digest pSB1C3 (16n/u), Ana (35n/u), CscB (40n/u)
• made 50ul digests using Knight lab protocol; 1ul of each RE, 1x BSA, digested 18ul of Ana, 18ul of CscB, 42.5ul of pSB1C3
• incubated at 37C for 2hr, heat kill enzyme at 80C for 20min
• digest cleanup massacred yield ( -__- ); Nanodrop readings: pSB1C3 (3.7), Ana (6), CscB (9.8)
• transformation:
• made pRL623@DH5aMCR competent with the CT4 fast CaCl2 protocol, and transformed with plasmid-prepped pRL25. Streaked to cm+kan plates.

REGOBricks

• Gradient Phusion PCR:
  • Same protocol as above, but varied template volume (1.5 or 2 uL), DMSO (.6, .8, 1.2, 1.6 uL) and temperature 45-55?.
  • Best results returned with higher (1.2 uL) DMSO, higher (2 uL) template, and higher (>50?) temperature. Our next PCR (8/17) was performed with these variables.