From 2011.igem.org

Revision as of 15:28, 21 June 2011 by Pvandieken (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Making LB Medium (P1.)

Luria-Bertani Medium (aka L-Broth or LB Medium). (Bertani says LB really stands for lysogeny broth.) LB is a standard growth medium for a variety of bacteria and conditions.

Ingredients

10 g Bacto-tryptone
5 g yeast extract
10 g NaCl

Note: There are two formulations of LB, Miller and Lennox, that differ in the amount of NaCl. Lennox has less salt, only 5 g/L. The Qiagen miniprep kit recommends LB with 10 g NaCl for highest plasmid yields.

Protocol

Mix dry ingredients and add distilled water up to 1 Liter
Pour into 2 L flask (or greater)
Autoclave (liquid cycle)
- 250°F, 22psi, 30 minutes

Notes: We do not pH medium when we make it on the fly. However, if it is really important, pH the medium to 7.0 with 5M NaOH (~200µL). We usually obtain this from the kitchen.

Source

Adapted From:

J. Sambrook, D.W. Russell, Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, New York, ed. 3, 2001) pg. A2.2

Making SOB Medium (P2.)

SOB Medium. Used in growing bacteria for preparing chemically competent cells

Ingredients

0.5% (w/v) yeast extract
2% (w/v) tryptone
10 mM NaCl
2.5 mM KCl
20 mM MgSO₄

Per liter:

5 g yeast extract
20 g tryptone
0.584 g NaCl
0.186 g KCl
2.4 g MgSO₄

Note: Some formulations of SOB use 10 mM MgCl₂ and 10 mM MgSO₄ instead of 20 mM MgSO₄.

SOB medium is also available dry premixed from Difco, 0443-17.

Adjust to pH 7.5 prior to use. This requires approximately 25 ml of 1M NaOH per liter.

15/10 medium

Growth of competent TOP10 cells in Example 2 of the Bloom05 patent is performed in 15/10 broth, which is similar to SOB:

1.5% yeast extract
1% Bacto-Tryptone
10mM NaCl
2mM KCl
10 mM MgCl₂
10 mM MgSO₄

Source

Adapted From:

F. Ausubel et al., Short Protocols in Molecular Biology (John Wiley & Sons, ed. 4, 1999) pg. A1-36

Making SOC Medium (P3.)

SOC Medium.

Ingredients

SOB
20 mM glucose

Protocol

Follow directions to make 1 liter of Making SOB Medium (P2.) media
After cooling medium to less than 50°C, add 20 ml filter sterilized 20% glucose solution

Source

Adapted From:

F. Ausubel et al., Short Protocols in Molecular Biology (John Wiley & Sons, ed. 4, 1999) pg. A1-36

Making Competent Cells (P4.)

This protocol is a variant of the Hanahan protocol Hanahan91 using CCMB80 buffer for DH10B, TOP10 and MachI strains. It builds on Example 2 of the [http://openwetware.org/images/b/bd/Pat6855494.pdf Bloom05 patent] as well. This protocol has been tested on NEB10, TOP10, MachI and [http://openwetware.org/wiki/Talk:TOP10_chemically_competent_cells BL21(DE3)] cells. See [http://openwetware.org/wiki/Bacterial_Transformation OWW Bacterial Transformation page] for a more general discussion of other techniques. The [http://openwetware.org/images/0/0c/Pat6960464.pdf Jesse '464 patent] describes using this buffer for DH5α cells. The [http://openwetware.org/images/c/c2/Pat6709852.pdf Bloom04] patent describes the use of essentially the same protocol for the Invitrogen Mach 1 cells.

This is the chemical transformation protocol used by Tom Knight and the [http://partsregistry.org Registry of Standard Biological Parts].

Materials

Detergent-free, sterile glassware and plasticware (see procedure)
Table-top OD600nm spectrophotometer
SOB

CCMB80 buffer

10 mM KOAc pH 7.0 (10 ml of a 1M stock/L)
80 mM CaCl₂.2H₂O (11.8 g/L)
20 mM MnCl₂.4H₂O (4.0 g/L)
10 mM MgCl₂.6H₂O (2.0 g/L)
10% glycerol (100 ml/L)
adjust pH DOWN to 6.4 with 0.1N HCl if necessary
- adjusting pH up will precipitate manganese dioxide from Mn containing solutions.
sterile filter and store at 4°C
slight dark precipitate appears not to affect its function

Procedure

Preparing glassware and media

Eliminating detergent

Detergent is a major inhibitor of competent cell growth and transformation. Glass and plastic must be detergent free for these protocols. The easiest way to do this is to avoid washing glassware, and simply rinse it out. Autoclaving glassware filled 3/4 with DI water is an effective way to remove most detergent residue. Media and buffers should be prepared in detergent free glassware and cultures grown up in detergent free glassware.

Prechill plasticware and glassware

Prechill 250mL centrifuge tubes and screw cap tubes before use.

Preparing seed stocks

Streak TOP10 cells on an SOB plate and grow for single colonies at 23°C
- room temperature works well
Pick single colonies into 2 ml of SOB medium and shake overnight at 23°C
- room temperature works well
Add glycerol to 15%
Aliquot 1 ml samples to Nunc cryotubes
Place tubes into a zip lock bag, immerse bag into a dry ice/ethanol bath for 5 minutes
- This step may not be necessary
Place in -80°C freezer indefinitely.

Preparing competent cells

Inoculate 250 ml of SOB medium with 1 ml vial of seed stock and grow at 20°C to an OD600nm of 0.3
- This takes approximately 16 hours.
- Controlling the temperature makes this a more reproducible process, but is not essential.
- Room temperature will work. You can adjust this temperature somewhat to fit your schedule
- Aim for lower, not higher OD if you can't hit this mark
Centrifuge at 3000g at 4°C for 10 minutes in a flat bottom centrifuge bottle.
- Flat bottom centrifuge tubes make the fragile cells much easier to resuspend
- It is often easier to resuspend pellets by mixing before adding large amounts of buffer
Gently resuspend in 80 ml of ice cold CCMB80 buffer
- sometimes this is less than completely gentle. It still works.
Incubate on ice 20 minutes
Centrifuge again at 4°C and resuspend in 10 ml of ice cold CCMB80 buffer.
Test OD of a mixture of 200 μl SOC and 50 μl of the resuspended cells.
Add chilled CCMB80 to yield a final OD of 1.0-1.5 in this test.
Incubate on ice for 20 minutes
Aliquot to chilled screw top 2 ml vials or 50 μl into chilled microtiter plates
Store at -80°C indefinitely.
- Flash freezing does not appear to be necessary
Test competence (see below)
Thawing and refreezing partially used cell aliquots dramatically reduces transformation efficiency by about 3x the first time, and about 6x total after several freeze/thaw cycles.

Measurement of competence

Transform 50 μl of cells with 1 μl of standard pUC19 plasmid (Invitrogen)
- This is at 10 pg/μl or 10^-5 μg/μl
- This can be made by diluting 1 μl of NEB pUC19 plasmid (1 μg/μl, NEB part number N3401S) into 100 ml of TE
Hold on ice 0.5 hours
Heat shock 60 sec at 42C
Add 250 μl SOC
Incubate at 37 C for 1 hour in 2 ml centrifuge tubes rotated
- using 2ml centrifuge tubes for transformation and regrowth works well because the small volumes flow well when rotated, increasing aeration.
- For our plasmids (pSB1AC3, pSB1AT3) which are chloramphenicol and tetracycline resistant, we find growing for 2 hours yields many more colonies
- Ampicillin and kanamycin appear to do fine with 1 hour growth
Plate 20 μl on AMP plates using sterile 3.5 mm glass beads
- Good cells should yield around 100 - 400 colonies
- Transformation efficiency is (dilution factor=15) x colony count x 10⁵/µgDNA
- We expect that the transformation efficiency should be between 5x10⁸ and 5x10⁹ cfu/µgDNA

5x Ligation Adjustment Buffer

Intended to be mixed with ligation reactions to adjust buffer composition to be near the CCMB80 buffer
KOAc 40 mM (40 ml/liter of 1 M KOAc solution, pH 7.0)
CaCl₂ 400 mM (200 ml/l of a 2 M solution)
MnCl₂ 100 mM (100 ml/l of a 1 M solution)
Glycerol 46.8% (468 ml/liter)
pH adjustment with 2.3% of a 10% acetic acid solution (12.8ml/liter)
- Previous protocol indicated amount of acetic acid added should be 23 ml/liter but that amount was found to be 2X too much per tests on 1.23.07 --Meagan 15:50, 25 January 2007 (EST)
water to 1 liter
autoclave or sterile filter
Test pH adjustment by mixing 4 parts ligation buffer + 1 part 5x ligation adjustment buffer and checking pH to be 6.3 - 6.5

Reshma P. Shetty 10:49, 11 February 2008 (CST): Use of the ligation adjustment buffer is optional.

References

Hanahan91 pmid=1943786
Reusch86 pmid=3536850
Addison04 pmid=15470891
Bloom04 US Patent 6,709,852 [http://openwetware.org/images/c/c2/Pat6709852.pdf pat6709852.pdf]
Bloom05 US Patent 6,855,494 [http://openwetware.org/images/b/bd/Pat6855494.pdf pat6855494.pdf]
Jesse05 US Patent 6,960,464 [http://openwetware.org/images/0/0c/Pat6960464.pdf pat6960464.pdf]

Linearized Plasmid Backbones

This protocol was developed by Tom Knight, samples of standard Registry plasmid backbones prepared using this method were sent out in the Spring 2011 DNA Distribution kits.

Short single stranded DNA fragments will not ligate to 4 bp overhangs. By creating a very short overhang on a PCR of a plasmid backbone, the remnant, when cut with EcoRI and PstI is sufficiently short that it will not anneal at ligation temperature, and will therefore not ligate. This allows us to build high quality construction plasmid backbone without purifying away the cut fragments remaining after PCR.

We are distributing the prepared construction plasmid as purified PCR products, diluted to standard concentration, but prior to cutting with EcoRI and PstI. Standard assembly will cut this plasmid backbone with EcoRI and PstI at the same time that the two assembled fragments are cut with EcoRI and SpeI and with XbaI and PstI, respectively.

The preparation of this PCR fragment is done with primers having short overhangs past the EcoRI and PstI sites, followed by PCR cleanup, dilution to standard concentration, and quality control testing.

Note: The Registry shipping plasmid backbone is pSB1C3. If you are making linearized plasmid backbone in order to send parts to the Registry, you must use pBS1C3.

Primers:

gccgctgcagtccggcaaaaaa,SB-prep-3P-1
atgaattccagaaatcatccttagcg,SB-prep-2Ea

Diluted to 30 pmol/ul

These primers have been tested with pSB1C3, pSB1A3, pSB1K3, and pSB1T3.

Using the Linearized Plasmid Backbones (P5.)

The Spring 2011 DNA Distribution should come with a set of linearized plasmid backbones: pSB1A3, pSB1C3, pSB1K3, and pSB1T3. The linearized plasmid backbones (25ng/ul at 50ul) should be stored at 4C or lower. Prior to ligation the plasmid backbones need to be cut with EcoRI and PstI.

Digest

Enzyme Master Mix for Plasmid Backbone (25ul total, for 6 rxns)
- 5 ul NEB Buffer 2
- 0.5 ul BSA
- 0.5 ul [http://www.neb.com/nebecomm/products/productR3101.asp EcoRI-HF]
- 0.5 ul [http://www.neb.com/nebecomm/products/productR0140.asp PstI]
- 0.5 ul [http://www.neb.com/nebecomm/products/productR0176.asp DpnI]
- 18 ul dH20

Digest Plasmid Backbone
- Add 4 ul linearized plasmid backbone (25ng/ul for 100ng total)
- Add 4 ul of Enzyme Master Mix
- Digest 37C/30 min, heat kill 80C/20 min

Ligation

Add 2ul of digested plasmid backbone (25 ng)
Add equimolar amount of EcoRI-HF SpeI digested fragment (< 3 ul)
Add equimolar amount of XbaI PstI digested fragment (< 3 ul)
Add 1 ul [http://www.neb.com/nebecomm/products/productm0202.asp T4 DNA ligase buffer]. Note: Do not use quick ligase
Add 0.5 ul [http://www.neb.com/nebecomm/products/productm0202.asp T4 DNA ligase]
Add water to 10 ul
Ligate 16C/30 min, heat kill 80C/20 min
Transform with 1-2 ul of product

Making Linearized Plasmid Backbones

Bulk Production

The following is the protocol that we used to create the linearized plasmid backbones shipped with the Spring 2011 DNA Distribution. The protocol is in 96 well format, but may be scaled down to suit smaller batches.

2011 Plasmid Backbone Production

PCR mix

9.6ml of [http://products.invitrogen.com/ivgn/product/10790020?ICID=search-10790020 PCR Supermix High Fidelity]
67 ul of primer SB-prep-2Eb
67 ul of primer SB-prep-3P-1
10 ul of template DNA at 10ng/ul (100ng total) (Note: Do not use a sample of linearized plasmid backbones (PCRed) as a template)
Aliquot 100ul per well in 96 well plate

PCR program

95C/2min
95C/30s
55C/30s
68C/3min
Repeat cycle (steps 2 to 4, 37 more times)
68C/10min

PCR cleanup

Purification of 96 well plates was done through Promega [http://www.promega.com/products/dna-and-rna-purification/dna-fragment-purification/wizard-sv-96-pcr-clean_up-system/ Wizard SV 96 PCR Clean-Up kit] and a vacuum manifold. The protocol below follows the manual, with a few changes (in bold), however please see manual for setup instructions.

Add equal volume of Binding Solution to PCR product (add 100ul of Binding Solution to 100ul of product)
Mix by pipetting, transfer all 200ul to Binding Plate, let sit for 1 min
Apply vacuum until samples pass through, about 30s to 1 min
Add 200 ul of freshly prepared 80% ethanol to Binding Plate, let sit for 1min, apply vacuum until ethanol passes through, about 20s to 1 min.
Repeat ethanol wash (step 4) twice more for three washes total
Remove Binding Plate from wash manifold, blot on kim wipes, reinstall in wash manifold
Apply vacuum for 4 min to fully dry Binding Plate
Remove Binding Plate from wash manifold, blot on kim wipes, reinstall in collection manifold
Add 50ul of TE buffer, let sit for 1 min, apply vacuum until eluted, about 1 min
Repeat 50ul elution (step 9) for a total elution of 100ul
Measure concentration on nanodrop, adjust to 25 ng/ul with TE

Single Reaction PCR

PCR mix

100 ul [http://products.invitrogen.com/ivgn/product/10790020?ICID=search-10790020 PCR Supermix High Fidelity]
0.7 ul of SB-prep-3P-1
0.7 ul of SB-prep-2Ea
0.5 ul template DNA at 10 ng/ul (Note: Do not use a sample of linearized plasmid backbones (PCRed) as a template)

PCR program

94C/2min
94C/30s
55C/30s
68C/3min
Repeat cycle (steps 2 to 4, 35 more times)
68C/10min
Digest with DpnI enzyme: 2ul in 100ul reaction, incubate 37C/hour; heat kill 80C/20min

PCR cleanup

[http://www.qiagen.com/products/dnacleanup/gelpcrsicleanupsystems/qiaquickpcrpurificationkit.aspx QIAquick PCR Purification]

Add 500 ul Qiagen buffer PB
Spin through a column twice, discard flowthrough
Wash 1x with 700 ul buffer PB
Wash 2x with 760 ul buffer PE
Discard liquid, spin dry at 17000g for 3 min
Elute into a new tube twice with 50 ul of TE (100 ul total)

Quality Control

We recommend QCing constructed linearized plasmid backbones, to test success of PCR, ligation efficiency, and background.

Run unpurified PCR product (1 ul) on a gel to verify the correct band and concentration and lack of side products.
Test concentration of purified PCR product. Note: Expected yield should be 40ng/ul or higher. Adjust to 25ng/ul with TE.
Run a digest and ligation test with purified PCR product to determine EcoRI and PstI cutting and ligation efficiency.

Digest

Digest Master Mix (10rxns)
- 15 ul NEB Buffer 2
- 1.5 ul BSA
- 90 ul dH20

Run Digest
- 4 ul of plasmid backbone (approximately 100 ng)
- 10.5 ul of Digest Master Mix
- 0.5 ul either EcoRI-HF or PstI enzyme (not both!)
- Digest 37C/30min; 80C/20 min
- Proceed directly to ligation

Ligation

Ligation Master Mix (10rxns)
- 20 ul T4 DNA ligase buffer
- 5 ul T4 DNA ligase
- 25 ul water

Ligation Test
- Add 5 ul of ligation master mix to digested product
- Ligate 16C/30min; 80C/20 min
- Run all 20 ul on a gel
- Compare intensity of the single and double length bands. More efficient ligations will show stronger double length bands than single.

Transformation test

Transform 1 ul of the diluted final product into highly competent cells
Control transform 10 pg of pUC19
Plate on the appropriate antibiotic
Observe few colonies. Any colonies represent background to the three antibiotic assembly process
Quantify the effective amount of remaining circular DNA able to transform

Linearized Plasmid Backbones Original Protocol

Team:Amsterdam/Labwork/Protocols

From 2011.igem.org

Contents

Making LB Medium (P1.)

Ingredients

Protocol

Source

Making SOB Medium (P2.)

Ingredients

15/10 medium

Source

Making SOC Medium (P3.)

Ingredients

Protocol

Source

Making Competent Cells (P4.)

Materials

CCMB80 buffer

Procedure

Preparing glassware and media

Eliminating detergent

Prechill plasticware and glassware

Preparing seed stocks

Preparing competent cells

Measurement of competence

5x Ligation Adjustment Buffer

References

Linearized Plasmid Backbones

Using the Linearized Plasmid Backbones (P5.)

Digest

Ligation

Making Linearized Plasmid Backbones

Bulk Production

PCR mix

PCR program

PCR cleanup

Single Reaction PCR

PCR mix

PCR program

PCR cleanup

Quality Control

Digest

Ligation

Transformation test