Team:ETH Zurich/Biology/MolecularMechanism

From 2011.igem.org

(Difference between revisions)
(Plasmid design)
(Cloning successes and problems)
 
(163 intermediate revisions not shown)
Line 1: Line 1:
-
{{:Team:ETH Zurich/Templates/Header/Biology|currPage=MolecularMechanism}}
+
{{:Team:ETH Zurich/Templates/HeaderNew}}
-
{|class="roundContainer"
+
-
|style="font-size:2em; height: 30px" class="biology"|Circuit design
+
-
|
+
-
{|class="biologyTitle linkMap" align="right"
+
-
|-
+
-
|style="border-left: none;"|[[#Circuit design|Circuit design]]
+
-
|[[#Plasmid strategy|Plasmid strategy]]
+
-
|}
+
-
|-
+
-
|colspan="2"|'''We combined a Smoke-sensitive band-pass filter with GFP output with a quorum-sensing diffusive mechanism that alarms the user of the system to high Xylene levels by expressing RFP.'''
+
-
|}
+
 +
{{:Team:ETH Zurich/Templates/SectionStart}}
 +
= Genetic Design =
 +
'''In a System where so many trancriptional regulators effect each other, their respective levels are very important factor in the establishment of a running system.''' The expression rate is controlled with a multi plasmid operation where the genes are assembled on different plasmids with different copy numbers. Also we put a lot of effort in the design of the ribosome binding site. Below we provide a description of the plasmid design, the strategy we used to clone the necessary parts and the method of choosing the ribosome binding sites.
 +
{{:Team:ETH Zurich/Templates/SectionEnd}}
 +
{{:Team:ETH Zurich/Templates/SectionStart}}
-
{|class="roundContainer"
+
= Plasmid design =
-
|
+
[[File:Table_alcR.png|600px|right|thumb|'''Table 1: Plasmid design for the AlcR system''' Transcriptional terminators included for each gene. Plasmid copy numbers adapted from [[#Ref1|[1]]].]]
-
==Circuit design ==
+
[[File:Table_xylR.png|600px|right|thumb|'''Table 2: Plasmid design for the XylR system''' Transcriptional terminators included for each gene. Plasmid copy numbers adapted from [[#Ref1|[1]]]. For a detailed description of the pCK04AxylR plasmid see [[#Ref3|[3]]].]]
 +
[[File:Table araC.png|600px|right|thumb|'''Table 3: Plasmid design for the AraC test system''' Transcriptional terminators included for each gene. Plasmid copy numbers adapted from [[#Ref1|[1]]].]]
-
[[File:ETH_states_of_bandpass.png|300px|right|thumb|'''Circuit operations for SmoColi''' exposed to medium, low and zero xylene concentration resulting in a GFP band. Triangles indicating the gradient of AHL (blue) and sensor molecule (violett), receptively. Non active interactions and non expressed Proteins are indicated light colors.]]
 
-
SmoColi is a bacterio quantifier which can be activated with different signal, we implemented two of them acetaldehyde and xylene.
+
For the biological implementation of the SmoColi system, we constructed a '''three-plasmid system''' with different antibiotic resistances. This setup was chosen in order to clone the whole SmoColi system into the same bacterial cells.
-
The concentration gradient which is needed for SmoColi is either naturally or achieved by synthetic cellular degradation. For example in case of Xylene we included the upper Tol pathway of ''Pseudomonas putida'' in SmoColi [[#Ref1|[1]]]. In contrast acetaldeydhde is naturally degraded.
+
-
+
-
In our system we can use different small molceules  as an activating input for the bandpass-filter [[#Ref2|[2]]]. The repressor which is activated by the small molecule is constantly expressed and enhances the expression of the LacI<sub>M1</sub> repressor (codon-modified LacI) and the lambda repressor CI, which are under control of the Xyl-Promotor, respectively. High xylene concentration results in high cytoplasmic levels of CI and of LacI<sub>M1</sub> and repression of the green fluorescent protein (GFP).  Cells that are far from the input have low xylene concentrations, because of xylene degradation. Accordingly, LacI<sub>M1</sub> and CI are only expressed at basal level. Without repression of the lamda promoter wild-type LacI is produced and represses the production of GFP. At the same point the N-Acyl homoserine lactone (AHL) Synthase LuxI is produced, AHL binds to LuxR which is constantly expressed and represses the red fluorescent protein (RFP). AHL is a quorum-sensing molecule with a high diffusion rate, it diffuses through the whole tube and represses RFP production in the whole tube, even in cells where no AHL is produced.
+
-
[[File:ETH_states_of_alarm.png|300px|left|thumb|'''Circuit operations for SmoColi''' exposed to very high xylene concentration resulting in an alarmsystem which turns the whole channel red. The triangle is indicating the sensor molecule concentration. Non active interactions and non expressed Proteins are indicated light colors.]]
+
The vectors used in our setup are the parts pSB6A5, pSB3C5, pSB4C5, pSB3K3 and pSB4K5. These plasmids contain different origins of replication, thus resulting in different copy numbers of the corresponding plasmid in ''E.coli''. pBR322, p15A and pSC101 origins are used as a stable three-plasmid system [[#Ref2|[2]]]. The copy number influences the amount of protein produced by the cell and plays a crucial role in our design, especially for the bandpass filter. Depending on the function of a particular protein in our system we had to evaluate on which plasmid the corresponding gene should be cloned.
-
If the xylene concentration is too high and it can not be degraded within the tube, no AHL is produced. Without AHL LuxR does not repress RFP and the whole tube turns red. To obtain better dynamics we tagged GFP and TetR with LVA tags.  
+
In the xylene-responsive system we included an artificial degradation pathway (''xylWCMABN'') so that we could establish a xylene gradient. For this purpose the plasmid pCK04AxylR was added [[#Ref3|[3]]]. To avoid incompatibilities of plasmids we adapted the rest of our system and changed the composition of the genes on each vector compared to the AlcR system.
-
Finally we can also use a negative input for our system, in this case we have to introduce an additional inverter to invert the negative input signal into a positive one. Therefore the tetracycline repressor protein (TetR) was used in case of AlcR. If acetalydeyhde is present AlcR binds to the promotor of TetR and inhibit its represssion, resulting in no TetR.
+
For proof of concept of the bandpass filter, we also constructed a system with AraC as an arabinose-dependent sensor. Here we again change the plasmid design in order to match the requirements of the test system. Therefore we introduced a plasmid (pSB4C5) containing the ''araC'' regulator gene and the degradation pathway for arabinose, ''araBAD''. Since AraC is activating P<sub>BAD</sub> upon sensing arabinose, the design for the other two plasmids could be adapted from the design of the xylene system. Only P<sub>u</sub> promoters were exchanged with P<sub>BAD</sub>.
 +
<br clear="all" />
 +
==pSB6A5==
 +
[[File:GoldPlasmid.png|300px|left|thumb|'''Figure 1: Improvement of the plasmid pSB6A1 to pSB6A5''']]
 +
The pSB6A5 plasmid we constructed by '''reducing the size''' of the antibotic (Ampicillin) and origin of replication (pMB1) casettes of pSB6A1 to a minimum and by introducing '''terminators around the multiple cloning site'''. PMB1 is a medium copy orign with about 15-20 copies per cell. For the characterization of pSB6A5 [[Team:ETH_Zurich/Biology/Validation#Copy number test|click here]]
 +
{{:Team:ETH Zurich/Templates/SectionEnd}}
 +
{{:Team:ETH Zurich/Templates/SectionStart}}
 +
=Cloning strategy =
 +
== General procedure ==
-
|}
+
[[File:ETHZ_Biobrick_cloning_2.png|350px|left|thumb|'''Figure 1: Cloning strategy for SmoColi''']]
-
{|class="roundContainer"
 
-
|
 
-
==Plasmid design ==
 
-
For the biological implementation of the SmoColi system, we constructed a 3 plasmid system with different antibiotic resistances. This is necessary in order to construct the whole network into the same bacterial cell.
 
-
The vectors used in our setup are the parts pSB6A5, pSB3C5, pSB3K3 and pSB4K5. These plasmids contain different origins of replication, thus resulting in different copy numbers of the plasmid in ''e.coli''. The copy number influences the amount of protein produced by the cell. Depending on the function of a particular protein in our system we chose on which plasmid the corresponding gene should be cloned.
+
For cloning our parts we tried to follow the strategies proposed in the registry of standard biological parts [[#Ref4|[4]]] as much as possible . The general cloning scheme was performed as follows:
 +
* If available, genes and promoters in SmoColi were obtained from the iGEM spring 2011 distribution kit. A codon-optimized version of ''alcR'' and ''P<sub>tet</sub>-lacI<sub>M1</sub>'' were synthesized. ''P<sub>alc</sub>''- and ''P<sub>U</sub>''-promoters were obtained by PCR.
-
{| border="1" align="center" style="text-align:left;"
+
* After isolation of the DNA, ribosome binding sites and prefix (5' gaattcgcggccgcttctagag 3') respectively suffix (5' tactagtagcggccgctgcag 3') were added to the gene by polymerase chain reaction. The PCR products were purified and afterwards digested with ''XbaI-PstI''.
-
|'''Origin'''
+
-
|'''Copy number'''
+
-
|'''Resistance'''
+
-
|'''Genes'''
+
-
|-
+
-
|pBR322
+
-
|15-20
+
-
|ampicillin
+
-
|P<sub>U</sub>-LacI<sub>M1</sub>; P<sub>lac</sub>-GFP<sub>LVA</sub>; P<sub>LuxR</sub>-RFP
+
-
|-
+
-
|p15A
+
-
|10-12
+
-
|chloramphenicol
+
-
|P<sub>U</sub>-CI; λ<sub>P(R-O12)</sub>-LacI; P<sub>const</sub>-LuxR
+
-
|-
+
-
|psC101
+
-
|5
+
-
|kanamycin
+
-
|P<sub>const</sub>-XylR; degadation pathway of xylene
+
-
|+ Plasmid strategy for system with xylene sensor
+
-
|}
+
 +
* Plasmid vectors containing the corresponding promoter were linearized by ''SpeI-PstI'' and the ''XbaI-PstI'' fragment containing the gene of interest was ligated into the backbone.
-
{| border="1" align="center" style="text-align:left;"
+
* In a next step we isolated a ''EcoRI-SpeI'' fragment with promoter, ribosome binding site and gene and inserted it into a ''EcoRI-XbaI'' cut vector containing a transcriptional terminator.
-
|'''Origin'''
+
-
|'''Copy number'''
+
-
|'''Resistance'''
+
-
|'''Genes'''
+
-
|-
+
-
|pBR322
+
-
|15-20
+
-
|ampicillin
+
-
|P<sub>tet</sub>-LacI<sub>M1</sub>; P<sub>const</sub>-AlcR; P<sub>const</sub>-LuxR
+
-
|-
+
-
|p15A
+
-
|10-12
+
-
|chloramphenicol
+
-
|P<sub>tet</sub>-CI; λ<sub>P(R-O12)</sub>-LacI; P<sub>const</sub>-TetR<sub>LVA</sub>
+
-
|-
+
-
|psC101
+
-
|5
+
-
|kanamycin
+
-
|P<sub></sub>-GFP<sub>LVA</sub>; P<sub>luxR</sub>-RFP
+
-
|+ Plasmid strategy for system with acetaldehyde sensor
+
-
|}
+
 +
* In the end all the constructed parts were assembled on the corresponding vectors for the final SmoColi system. Some parts (especially ''lacI'' in an actively expressed form) appeared to be negatively selected by ''E.coli''. So we had to assemble the parts in a way that ''lacI'' was always repressed.
 +
<br clear="all" />
-
http://www.springerlink.com/content/3fj1xxl9p42kx8l5/
+
== Sources of genes and promoters ==
 +
[[File:ETH Plasmids.png|400px|right|thumb|'''Table 4: Promoters of SmoColi:''' source and final constructs of the different used promoters]]
 +
[[File:ETH plasmid2.png|400px|left|thumb|'''Table 3: Genes of SmoColi: '''source and final constructs of the different used genes]]
-
|}
+
<br clear="all" />
-
{|class="roundContainer"
+
== Cloning successes and problems ==
-
|
+
All parts of the system were successfully assembled by this strategy, except for ''lacI'' and ''cI'' under control of the Tet promoter. Whenever we were sequencing a clone of either of those constructs, we always found protein inactivating mutations within the primer annealing part - either being deletions of the Shine-Dalgarno sequence of the
 +
RBS or frame shift mutations within the first bases of the coding regions. We first believed the problem to lie in the synthesis of the very long oligonucleotides, for adding the whole RBS and prefix in front of the genes. But also performing a whole plasmid PCR with short primers did not solve the problem and we still only got non-protein-generating sequences.
 +
We believe this to be due to lethality of high overexpression levels of LacI or CI, leading to a selection for clones mutated in a way that ''lacI'' or ''cI'' is not expressed. Thus one always has to '''make sure to clone ''lacI'' or ''cI'' behind downregulated promoters''', for example for P<sub>Tet</sub> you have to make sure that there is TetR present in the cell. Those problems unforunately delayed the construction of the complete system to only shortly before Wikifreeze, thus we hope to produce as many results as possible till the Jamboree.
 +
{{:Team:ETH Zurich/Templates/SectionEnd}}
 +
{{:Team:ETH Zurich/Templates/SectionStart}}
-
== References ==
+
= Choice and design of ribosome binding sites =
-
<span id="Ref1">[1] [http://aem.asm.org/cgi/content/abstract/64/2/748 Sven Panke, Juan M. Sánchez-Romero, and Víctor de Lorenzo: '''Engineering of Quasi-Natural Pseudomonas putida Strains for Toluene Metabolism through an ortho-Cleavage Degradation Pathway''', Appl Environ Microbiol, February 1998, 64: 748-751]</span>
+
[[File:Table RBS.png|400px|left|thumb|'''Table 5: Different ribosome binding sites and their estimated strengths''' which are included in our design. The strengths of the sequences were estimated with a RBS strength calculator [[#Ref7|[7]]]. In the last column it is listed in front of which genes a particular RBS was added.]]
-
<span id="Ref2">[2] [http://www.nature.com/nature/journal/v434/n7037/full/nature03461.html Subhayu Basu, Yoram Gerchman1, Cynthia H. Collins, Frances H. Arnold & Ron Weiss: '''A synthetic multicellular system for programmed pattern formation''', Nature 2005, 434: 1130-11342]</span>
+
Another important role in the synthesis of proteins is played by the ribosome binding site (RBS), the location where the ribosomes are bound to the mRNA at the initiation of the translation process.
-
|}
+
The ribosome binding sites which we included in our system were designed in several different ways:
 +
 
 +
* For the bandpass filter we implemented the ones which are also used for the plasmids in [[#Ref5|[5]]].
 +
 
 +
* For the other parts we either tried to use '''naturally occurring ribosome binding sites''' or took specific ones from the Anderson library of ribosome binding sites [[#Ref6|[6]]].
 +
 
 +
The strength of all the ribosome binding sites used was estimated with a '''RBS calculator'''. Although the efficiency of protein synthesis is not directly proportional to the estimated values, they can still indicate whether a certain RBS is more or less strong. Below you can find a list of the different ribosome binding sites used, their estimated binding strengths and in front of which genes they were put.
 +
{{:Team:ETH Zurich/Templates/SectionEnd}}
 +
{{:Team:ETH Zurich/Templates/SectionStart}}
 +
 
 +
= References =
 +
<span id="Ref1">[1] [http://openwetware.org/wiki/Arking:JCAOligoTutorial8 OpenWetWare '''Arking: JCAOligoTutorial8''', 0 Jul 2008, 04:32 UTC. 21 Sep 2011, 01:32]</span>
 +
 
 +
<span id="Ref2">[2] [http://www.springerlink.com/content/3fj1xxl9p42kx8l5/ Karl Friehs: '''Plasmid Copy Number and Plasmid Stability''', Advances in Biochemical Engineering/Biotechnology, 2004, 86: 22-192]</span>
 +
 
 +
<span id="Ref3">[3] [http://aem.asm.org/cgi/content/abstract/64/2/748 Sven Panke, Juan M. Sánchez-Romero, and Víctor de Lorenzo: '''Engineering of Quasi-Natural Pseudomonas putida Strains for Toluene Metabolism through an ortho-Cleavage Degradation Pathway''', Appl Environ Microbiol, February 1998, 64: 748-751]</span>
 +
 
 +
<span id="Ref4">[4] [http://partsregistry.org/Help:Contents Registry of Standard Biological Parts '''Help:contents''' 21 Sep 2011, 02:59]</span>
 +
 
 +
<span id="Ref5">[5] [http://www.nature.com/nature/journal/v434/n7037/full/nature03461.html Subhayu Basu, Yoram Gerchman1, Cynthia H. Collins, Frances H. Arnold & Ron Weiss: '''A synthetic multicellular system for programmed pattern formation''', Nature, 2005, 434: 1130-11342]</span>
 +
 
 +
<span id="Ref6">[6] [http://partsregistry.org/Ribosome_Binding_Sites/Prokaryotic/Constitutive/Anderson J. Christopher Anderson '''Ribosome Binding Sites/Prokaryotic/Constitutive/Community Collection''' Registry of Standard Biological Parts, 21 Sep 2011, 08:49]</span>
 +
{{:Team:ETH Zurich/Templates/SectionEnd}}
 +
{{:Team:ETH Zurich/Templates/HeaderNewEnd}}

Latest revision as of 21:25, 28 October 2011

Can you feel the smoke tonight?
 

Contents

Genetic Design

In a System where so many trancriptional regulators effect each other, their respective levels are very important factor in the establishment of a running system. The expression rate is controlled with a multi plasmid operation where the genes are assembled on different plasmids with different copy numbers. Also we put a lot of effort in the design of the ribosome binding site. Below we provide a description of the plasmid design, the strategy we used to clone the necessary parts and the method of choosing the ribosome binding sites.

Plasmid design

Table 1: Plasmid design for the AlcR system Transcriptional terminators included for each gene. Plasmid copy numbers adapted from [1].
Table 2: Plasmid design for the XylR system Transcriptional terminators included for each gene. Plasmid copy numbers adapted from [1]. For a detailed description of the pCK04AxylR plasmid see [3].
Table 3: Plasmid design for the AraC test system Transcriptional terminators included for each gene. Plasmid copy numbers adapted from [1].


For the biological implementation of the SmoColi system, we constructed a three-plasmid system with different antibiotic resistances. This setup was chosen in order to clone the whole SmoColi system into the same bacterial cells.

The vectors used in our setup are the parts pSB6A5, pSB3C5, pSB4C5, pSB3K3 and pSB4K5. These plasmids contain different origins of replication, thus resulting in different copy numbers of the corresponding plasmid in E.coli. pBR322, p15A and pSC101 origins are used as a stable three-plasmid system [2]. The copy number influences the amount of protein produced by the cell and plays a crucial role in our design, especially for the bandpass filter. Depending on the function of a particular protein in our system we had to evaluate on which plasmid the corresponding gene should be cloned.

In the xylene-responsive system we included an artificial degradation pathway (xylWCMABN) so that we could establish a xylene gradient. For this purpose the plasmid pCK04AxylR was added [3]. To avoid incompatibilities of plasmids we adapted the rest of our system and changed the composition of the genes on each vector compared to the AlcR system.

For proof of concept of the bandpass filter, we also constructed a system with AraC as an arabinose-dependent sensor. Here we again change the plasmid design in order to match the requirements of the test system. Therefore we introduced a plasmid (pSB4C5) containing the araC regulator gene and the degradation pathway for arabinose, araBAD. Since AraC is activating PBAD upon sensing arabinose, the design for the other two plasmids could be adapted from the design of the xylene system. Only Pu promoters were exchanged with PBAD.

pSB6A5

Figure 1: Improvement of the plasmid pSB6A1 to pSB6A5

The pSB6A5 plasmid we constructed by reducing the size of the antibotic (Ampicillin) and origin of replication (pMB1) casettes of pSB6A1 to a minimum and by introducing terminators around the multiple cloning site. PMB1 is a medium copy orign with about 15-20 copies per cell. For the characterization of pSB6A5 click here


Cloning strategy

General procedure

Figure 1: Cloning strategy for SmoColi


For cloning our parts we tried to follow the strategies proposed in the registry of standard biological parts [4] as much as possible . The general cloning scheme was performed as follows:

  • If available, genes and promoters in SmoColi were obtained from the iGEM spring 2011 distribution kit. A codon-optimized version of alcR and Ptet-lacIM1 were synthesized. Palc- and PU-promoters were obtained by PCR.
  • After isolation of the DNA, ribosome binding sites and prefix (5' gaattcgcggccgcttctagag 3') respectively suffix (5' tactagtagcggccgctgcag 3') were added to the gene by polymerase chain reaction. The PCR products were purified and afterwards digested with XbaI-PstI.
  • Plasmid vectors containing the corresponding promoter were linearized by SpeI-PstI and the XbaI-PstI fragment containing the gene of interest was ligated into the backbone.
  • In a next step we isolated a EcoRI-SpeI fragment with promoter, ribosome binding site and gene and inserted it into a EcoRI-XbaI cut vector containing a transcriptional terminator.
  • In the end all the constructed parts were assembled on the corresponding vectors for the final SmoColi system. Some parts (especially lacI in an actively expressed form) appeared to be negatively selected by E.coli. So we had to assemble the parts in a way that lacI was always repressed.


Sources of genes and promoters

Table 4: Promoters of SmoColi: source and final constructs of the different used promoters
Table 3: Genes of SmoColi: source and final constructs of the different used genes


Cloning successes and problems

All parts of the system were successfully assembled by this strategy, except for lacI and cI under control of the Tet promoter. Whenever we were sequencing a clone of either of those constructs, we always found protein inactivating mutations within the primer annealing part - either being deletions of the Shine-Dalgarno sequence of the RBS or frame shift mutations within the first bases of the coding regions. We first believed the problem to lie in the synthesis of the very long oligonucleotides, for adding the whole RBS and prefix in front of the genes. But also performing a whole plasmid PCR with short primers did not solve the problem and we still only got non-protein-generating sequences. We believe this to be due to lethality of high overexpression levels of LacI or CI, leading to a selection for clones mutated in a way that lacI or cI is not expressed. Thus one always has to make sure to clone lacI or cI behind downregulated promoters, for example for PTet you have to make sure that there is TetR present in the cell. Those problems unforunately delayed the construction of the complete system to only shortly before Wikifreeze, thus we hope to produce as many results as possible till the Jamboree.

Choice and design of ribosome binding sites

Table 5: Different ribosome binding sites and their estimated strengths which are included in our design. The strengths of the sequences were estimated with a RBS strength calculator [7]. In the last column it is listed in front of which genes a particular RBS was added.

Another important role in the synthesis of proteins is played by the ribosome binding site (RBS), the location where the ribosomes are bound to the mRNA at the initiation of the translation process. The ribosome binding sites which we included in our system were designed in several different ways:

  • For the bandpass filter we implemented the ones which are also used for the plasmids in [5].
  • For the other parts we either tried to use naturally occurring ribosome binding sites or took specific ones from the Anderson library of ribosome binding sites [6].

The strength of all the ribosome binding sites used was estimated with a RBS calculator. Although the efficiency of protein synthesis is not directly proportional to the estimated values, they can still indicate whether a certain RBS is more or less strong. Below you can find a list of the different ribosome binding sites used, their estimated binding strengths and in front of which genes they were put.

References

[1] [http://openwetware.org/wiki/Arking:JCAOligoTutorial8 OpenWetWare Arking: JCAOligoTutorial8, 0 Jul 2008, 04:32 UTC. 21 Sep 2011, 01:32]

[2] [http://www.springerlink.com/content/3fj1xxl9p42kx8l5/ Karl Friehs: Plasmid Copy Number and Plasmid Stability, Advances in Biochemical Engineering/Biotechnology, 2004, 86: 22-192]

[3] [http://aem.asm.org/cgi/content/abstract/64/2/748 Sven Panke, Juan M. Sánchez-Romero, and Víctor de Lorenzo: Engineering of Quasi-Natural Pseudomonas putida Strains for Toluene Metabolism through an ortho-Cleavage Degradation Pathway, Appl Environ Microbiol, February 1998, 64: 748-751]

[4] [http://partsregistry.org/Help:Contents Registry of Standard Biological Parts Help:contents 21 Sep 2011, 02:59]

[5] [http://www.nature.com/nature/journal/v434/n7037/full/nature03461.html Subhayu Basu, Yoram Gerchman1, Cynthia H. Collins, Frances H. Arnold & Ron Weiss: A synthetic multicellular system for programmed pattern formation, Nature, 2005, 434: 1130-11342]

[6] [http://partsregistry.org/Ribosome_Binding_Sites/Prokaryotic/Constitutive/Anderson J. Christopher Anderson Ribosome Binding Sites/Prokaryotic/Constitutive/Community Collection Registry of Standard Biological Parts, 21 Sep 2011, 08:49]

Back to iGEM Our Sponsors
ETHZ-BASF.png ETH Zurich Logo.png ETHZ-Lonza.png ETHZ-Merck Serono.png
ETHZ-Novartis.png ETHZ-Roche.png ETHZ-Syngenta.png DSM MasterLogo.png