Team:ETH Zurich/Biology/MolecularMechanism

From 2011.igem.org

(Difference between revisions)
(Plasmid design)
(Cloning successes and problems)
 
(41 intermediate revisions not shown)
Line 1: Line 1:
-
{{:Team:ETH Zurich/Templates/Header/Biology|currPage=MolecularMechanism}}
+
{{:Team:ETH Zurich/Templates/HeaderNew}}
-
{|class="roundContainer"
+
-
|style="font-size:2em; height: 30px" class="biology"|Genetic design
+
-
|
+
-
{|class="biologyTitle linkMap" align="right"
+
-
|-
+
-
|style="border-left: none;"|[[#Plasmid design|Plasmid design]]
+
-
|[[#Cloning strategy|Cloning strategy]]
+
-
|[[#Definition of ribosome binding sites|RBS]]
+
-
|}
+
-
|-
+
-
|colspan="2"|'''In a System where so many regulator effect each other the level of the single regulators is a very important factor to get a running system. The expression rate was controlled by a multi plasmid operation where the genes were assembled on different plasmids with different copy numbers. Also we put a lot of effort in the design of the ribosome binding site.''' Below we provide a description of the plasmid design protocols, the strategy we used to clone the necessary parts and the method of choosing the ribosome binding sites
+
-
|}
+
-
{|class="roundContainer"
+
{{:Team:ETH Zurich/Templates/SectionStart}}
-
|
+
= Genetic Design =
 +
'''In a System where so many trancriptional regulators effect each other, their respective levels are very important factor in the establishment of a running system.''' The expression rate is controlled with a multi plasmid operation where the genes are assembled on different plasmids with different copy numbers. Also we put a lot of effort in the design of the ribosome binding site. Below we provide a description of the plasmid design, the strategy we used to clone the necessary parts and the method of choosing the ribosome binding sites.
 +
{{:Team:ETH Zurich/Templates/SectionEnd}}
 +
{{:Team:ETH Zurich/Templates/SectionStart}}
-
=='''Plasmid design''' ==
+
= Plasmid design =
 +
[[File:Table_alcR.png|600px|right|thumb|'''Table 1: Plasmid design for the AlcR system''' Transcriptional terminators included for each gene. Plasmid copy numbers adapted from [[#Ref1|[1]]].]]
 +
[[File:Table_xylR.png|600px|right|thumb|'''Table 2: Plasmid design for the XylR system''' Transcriptional terminators included for each gene. Plasmid copy numbers adapted from [[#Ref1|[1]]]. For a detailed description of the pCK04AxylR plasmid see [[#Ref3|[3]]].]]
 +
[[File:Table araC.png|600px|right|thumb|'''Table 3: Plasmid design for the AraC test system''' Transcriptional terminators included for each gene. Plasmid copy numbers adapted from [[#Ref1|[1]]].]]
-
[[File:Table_alcR.png|400px|right|thumb|'''Table 1: Plasmid design for the AlcR system''' Transcriptional terminators included for each gene. Plasmid copy numbers adapted from [[#Ref4|[4]]].]]
 
-
[[File:Table_xylR.png|400px|right|thumb|'''Table 2: Plasmid design for the XylR system''' Transcriptional terminators included for each gene. Plasmid copy numbers adapted from [[#Ref4|[4]]]. For a detailed description of the pCK04AxylR plasmid see [[#Ref1|[1]]].]]
 
-
For the biological implementation of the SmoColi system, we constructed a three-plasmid system with different antibiotic resistances. This setup was chosen in order to clone the whole SmoColi system into the same bacterial cells.
+
For the biological implementation of the SmoColi system, we constructed a '''three-plasmid system''' with different antibiotic resistances. This setup was chosen in order to clone the whole SmoColi system into the same bacterial cells.
-
The vectors used in our setup are the parts pSB6A5, pSB3C5, pSB3K3 and pSB4K5. These plasmids contain different origins of replication, thus resulting in different copy numbers of the correlating plasmid in ''E.coli''. pBR322, p15A and pSC101 origins are used as a stable three-plasmid system [[#Ref3|[3]]]. The copy number influences the amount of protein produced by the cell and plays a crucial role in our design, especially for the bandpass filter. Depending on the function of a particular protein in our system we had to evaluate on which plasmid the corresponding gene should be cloned.  
+
The vectors used in our setup are the parts pSB6A5, pSB3C5, pSB4C5, pSB3K3 and pSB4K5. These plasmids contain different origins of replication, thus resulting in different copy numbers of the corresponding plasmid in ''E.coli''. pBR322, p15A and pSC101 origins are used as a stable three-plasmid system [[#Ref2|[2]]]. The copy number influences the amount of protein produced by the cell and plays a crucial role in our design, especially for the bandpass filter. Depending on the function of a particular protein in our system we had to evaluate on which plasmid the corresponding gene should be cloned.  
-
In the xylene-responsive system we included an artificial degradation pathway (''xylWCMABN'') so that we could establish a xylene gradient. For this purpose the plasmid pCK04AxylR was added [[#Ref1|[1]]]. To avoid incompatibilities of plasmids we adapted the rest of our system and changed the composition of the genes on each vector compared to the AlcR system.
+
In the xylene-responsive system we included an artificial degradation pathway (''xylWCMABN'') so that we could establish a xylene gradient. For this purpose the plasmid pCK04AxylR was added [[#Ref3|[3]]]. To avoid incompatibilities of plasmids we adapted the rest of our system and changed the composition of the genes on each vector compared to the AlcR system.
 +
 
 +
For proof of concept of the bandpass filter, we also constructed a system with AraC as an arabinose-dependent sensor. Here we again change the plasmid design in order to match the requirements of the test system. Therefore we introduced a plasmid (pSB4C5) containing the ''araC'' regulator gene and the degradation pathway for arabinose, ''araBAD''. Since AraC is activating P<sub>BAD</sub> upon sensing arabinose, the design for the other two plasmids could be adapted from the design of the xylene system. Only P<sub>u</sub> promoters were exchanged with P<sub>BAD</sub>.
<br clear="all" />
<br clear="all" />
-
'''pSB6A5'''
+
==pSB6A5==
[[File:GoldPlasmid.png|300px|left|thumb|'''Figure 1: Improvement of the plasmid pSB6A1 to pSB6A5''']]
[[File:GoldPlasmid.png|300px|left|thumb|'''Figure 1: Improvement of the plasmid pSB6A1 to pSB6A5''']]
-
The pSB6A5 plasmid we constructed by reducing the size of the antibotic (Ampicillin) and orign (pMB1) casette of pSB6A1 and introducing of Terminators around the multiple cloning site. PMB1 is a medium copy orign with about 15-20 copies per cell. For the characterization of pSB6A5 [[Team:ETH_Zurich/Biology/Validation#Copy number test|see experimental results]]
+
The pSB6A5 plasmid we constructed by '''reducing the size''' of the antibotic (Ampicillin) and origin of replication (pMB1) casettes of pSB6A1 to a minimum and by introducing '''terminators around the multiple cloning site'''. PMB1 is a medium copy orign with about 15-20 copies per cell. For the characterization of pSB6A5 [[Team:ETH_Zurich/Biology/Validation#Copy number test|click here]]
-
|}
+
-
{|class="roundContainer"
+
-
|
+
-
=='''Cloning strategy'''==
+
{{:Team:ETH Zurich/Templates/SectionEnd}}
 +
{{:Team:ETH Zurich/Templates/SectionStart}}
 +
=Cloning strategy =
== General procedure ==
== General procedure ==
Line 41: Line 34:
-
By cloning our parts we tried to follow the strategies proposed in the registry of standard biological parts [[#Ref5|[5]]] as much as possible . The general cloning scheme was performed as follows:
+
 
 +
For cloning our parts we tried to follow the strategies proposed in the registry of standard biological parts [[#Ref4|[4]]] as much as possible . The general cloning scheme was performed as follows:
* If available, genes and promoters in SmoColi were obtained from the iGEM spring 2011 distribution kit. A codon-optimized version of ''alcR'' and ''P<sub>tet</sub>-lacI<sub>M1</sub>'' were synthesized. ''P<sub>alc</sub>''- and ''P<sub>U</sub>''-promoters were obtained by PCR.  
* If available, genes and promoters in SmoColi were obtained from the iGEM spring 2011 distribution kit. A codon-optimized version of ''alcR'' and ''P<sub>tet</sub>-lacI<sub>M1</sub>'' were synthesized. ''P<sub>alc</sub>''- and ''P<sub>U</sub>''-promoters were obtained by PCR.  
Line 53: Line 47:
* In the end all the constructed parts were assembled on the corresponding vectors for the final SmoColi system. Some parts (especially ''lacI'' in an actively expressed form) appeared to be negatively selected by ''E.coli''. So we had to assemble the parts in a way that ''lacI'' was always repressed.
* In the end all the constructed parts were assembled on the corresponding vectors for the final SmoColi system. Some parts (especially ''lacI'' in an actively expressed form) appeared to be negatively selected by ''E.coli''. So we had to assemble the parts in a way that ''lacI'' was always repressed.
 +
<br clear="all" />
== Sources of genes and promoters ==
== Sources of genes and promoters ==
Line 63: Line 58:
All parts of the system were successfully assembled by this strategy, except for ''lacI'' and ''cI'' under control of the Tet promoter. Whenever we were sequencing a clone of either of those constructs, we always found protein inactivating mutations within the primer annealing part - either being deletions of the Shine-Dalgarno sequence of the  
All parts of the system were successfully assembled by this strategy, except for ''lacI'' and ''cI'' under control of the Tet promoter. Whenever we were sequencing a clone of either of those constructs, we always found protein inactivating mutations within the primer annealing part - either being deletions of the Shine-Dalgarno sequence of the  
RBS or frame shift mutations within the first bases of the coding regions. We first believed the problem to lie in the synthesis of the very long oligonucleotides, for adding the whole RBS and prefix in front of the genes. But also performing a whole plasmid PCR with short primers did not solve the problem and we still only got non-protein-generating sequences.
RBS or frame shift mutations within the first bases of the coding regions. We first believed the problem to lie in the synthesis of the very long oligonucleotides, for adding the whole RBS and prefix in front of the genes. But also performing a whole plasmid PCR with short primers did not solve the problem and we still only got non-protein-generating sequences.
-
We believe this to be due to lethality of high overexpression levels of LacI or CI, leading to a selection for clones mutated in a way that ''lacI'' or ''cI'' is not expressed. Thus one always has to make sure to clone ''lacI'' or ''cI'' behind downregulated promoters, for example for P<sub>tet</sub> you have to make sure that there is TetR present in the cell.
+
We believe this to be due to lethality of high overexpression levels of LacI or CI, leading to a selection for clones mutated in a way that ''lacI'' or ''cI'' is not expressed. Thus one always has to '''make sure to clone ''lacI'' or ''cI'' behind downregulated promoters''', for example for P<sub>Tet</sub> you have to make sure that there is TetR present in the cell. Those problems unforunately delayed the construction of the complete system to only shortly before Wikifreeze, thus we hope to produce as many results as possible till the Jamboree.
-
|}
+
{{:Team:ETH Zurich/Templates/SectionEnd}}
-
{|class="roundContainer"
+
{{:Team:ETH Zurich/Templates/SectionStart}}
-
|
+
-
 
+
-
=='''Definition of ribosome binding sites'''==
+
 +
= Choice and design of ribosome binding sites =
[[File:Table RBS.png|400px|left|thumb|'''Table 5: Different ribosome binding sites and their estimated strengths''' which are included in our design. The strengths of the sequences were estimated with a RBS strength calculator [[#Ref7|[7]]]. In the last column it is listed in front of which genes a particular RBS was added.]]
[[File:Table RBS.png|400px|left|thumb|'''Table 5: Different ribosome binding sites and their estimated strengths''' which are included in our design. The strengths of the sequences were estimated with a RBS strength calculator [[#Ref7|[7]]]. In the last column it is listed in front of which genes a particular RBS was added.]]
Line 75: Line 68:
The ribosome binding sites which we included in our system were designed in several different ways:
The ribosome binding sites which we included in our system were designed in several different ways:
-
* For the bandpass filter we implemented the ones which are also used for the plasmids in [[#Ref2|[2]]].
+
* For the bandpass filter we implemented the ones which are also used for the plasmids in [[#Ref5|[5]]].  
-
 
+
-
* For the other parts we either tried to use naturally ocuring ribosome binding sites or took specific ones from the Anderson library of ribosome binding sites [[#Ref6|[6]]].
+
-
 
+
-
The strength of all the ribosome binding sites used was estimated with a RBS calculator. Although the efficiency of protein synthesis is not directly proportional to the estimated values, they can still indicate whether a certain RBS is more or less strong. Below you can find a list of the different ribosome binding sites used, their estimated binding strengths and in front of which genes they were put.
+
 +
* For the other parts we either tried to use '''naturally occurring ribosome binding sites''' or took specific ones from the Anderson library of ribosome binding sites [[#Ref6|[6]]].
-
|}
+
The strength of all the ribosome binding sites used was estimated with a '''RBS calculator'''. Although the efficiency of protein synthesis is not directly proportional to the estimated values, they can still indicate whether a certain RBS is more or less strong. Below you can find a list of the different ribosome binding sites used, their estimated binding strengths and in front of which genes they were put.
-
{|class="roundContainer"
+
{{:Team:ETH Zurich/Templates/SectionEnd}}
-
|
+
{{:Team:ETH Zurich/Templates/SectionStart}}
-
== References ==
+
= References =
-
<span id="Ref1">[1] [http://aem.asm.org/cgi/content/abstract/64/2/748 Sven Panke, Juan M. Sánchez-Romero, and Víctor de Lorenzo: '''Engineering of Quasi-Natural Pseudomonas putida Strains for Toluene Metabolism through an ortho-Cleavage Degradation Pathway''', Appl Environ Microbiol, February 1998, 64: 748-751]</span>
+
<span id="Ref1">[1] [http://openwetware.org/wiki/Arking:JCAOligoTutorial8 OpenWetWare '''Arking: JCAOligoTutorial8''', 0 Jul 2008, 04:32 UTC. 21 Sep 2011, 01:32]</span>
-
<span id="Ref2">[2] [http://www.nature.com/nature/journal/v434/n7037/full/nature03461.html Subhayu Basu, Yoram Gerchman1, Cynthia H. Collins, Frances H. Arnold & Ron Weiss: '''A synthetic multicellular system for programmed pattern formation''', Nature, 2005, 434: 1130-11342]</span>
+
<span id="Ref2">[2] [http://www.springerlink.com/content/3fj1xxl9p42kx8l5/ Karl Friehs: '''Plasmid Copy Number and Plasmid Stability''', Advances in Biochemical Engineering/Biotechnology, 2004, 86: 22-192]</span>
-
<span id="Ref3">[3] [http://www.springerlink.com/content/3fj1xxl9p42kx8l5/ Karl Friehs: '''Plasmid Copy Number and Plasmid Stability''', Advances in Biochemical Engineering/Biotechnology, 2004, 86: 22-192]</span>
+
<span id="Ref3">[3] [http://aem.asm.org/cgi/content/abstract/64/2/748 Sven Panke, Juan M. Sánchez-Romero, and Víctor de Lorenzo: '''Engineering of Quasi-Natural Pseudomonas putida Strains for Toluene Metabolism through an ortho-Cleavage Degradation Pathway''', Appl Environ Microbiol, February 1998, 64: 748-751]</span>
-
<span id="Ref4">[4] [http://openwetware.org/wiki/Arking:JCAOligoTutorial8 OpenWetWare '''Arking: JCAOligoTutorial8''', 0 Jul 2008, 04:32 UTC. 21 Sep 2011, 01:32]</span>
+
<span id="Ref4">[4] [http://partsregistry.org/Help:Contents Registry of Standard Biological Parts '''Help:contents''' 21 Sep 2011, 02:59]</span>
-
<span id="Ref5">[5] [http://partsregistry.org/Help:Contents Registry of Standard Biological Parts '''Help:contents''' 21 Sep 2011, 02:59]</span>
+
<span id="Ref5">[5] [http://www.nature.com/nature/journal/v434/n7037/full/nature03461.html Subhayu Basu, Yoram Gerchman1, Cynthia H. Collins, Frances H. Arnold & Ron Weiss: '''A synthetic multicellular system for programmed pattern formation''', Nature, 2005, 434: 1130-11342]</span>
<span id="Ref6">[6] [http://partsregistry.org/Ribosome_Binding_Sites/Prokaryotic/Constitutive/Anderson J. Christopher Anderson '''Ribosome Binding Sites/Prokaryotic/Constitutive/Community Collection''' Registry of Standard Biological Parts, 21 Sep 2011, 08:49]</span>
<span id="Ref6">[6] [http://partsregistry.org/Ribosome_Binding_Sites/Prokaryotic/Constitutive/Anderson J. Christopher Anderson '''Ribosome Binding Sites/Prokaryotic/Constitutive/Community Collection''' Registry of Standard Biological Parts, 21 Sep 2011, 08:49]</span>
-
|}
+
{{:Team:ETH Zurich/Templates/SectionEnd}}
 +
{{:Team:ETH Zurich/Templates/HeaderNewEnd}}

Latest revision as of 21:25, 28 October 2011

Can you feel the smoke tonight?
 

Contents

Genetic Design

In a System where so many trancriptional regulators effect each other, their respective levels are very important factor in the establishment of a running system. The expression rate is controlled with a multi plasmid operation where the genes are assembled on different plasmids with different copy numbers. Also we put a lot of effort in the design of the ribosome binding site. Below we provide a description of the plasmid design, the strategy we used to clone the necessary parts and the method of choosing the ribosome binding sites.

Plasmid design

Table 1: Plasmid design for the AlcR system Transcriptional terminators included for each gene. Plasmid copy numbers adapted from [1].
Table 2: Plasmid design for the XylR system Transcriptional terminators included for each gene. Plasmid copy numbers adapted from [1]. For a detailed description of the pCK04AxylR plasmid see [3].
Table 3: Plasmid design for the AraC test system Transcriptional terminators included for each gene. Plasmid copy numbers adapted from [1].


For the biological implementation of the SmoColi system, we constructed a three-plasmid system with different antibiotic resistances. This setup was chosen in order to clone the whole SmoColi system into the same bacterial cells.

The vectors used in our setup are the parts pSB6A5, pSB3C5, pSB4C5, pSB3K3 and pSB4K5. These plasmids contain different origins of replication, thus resulting in different copy numbers of the corresponding plasmid in E.coli. pBR322, p15A and pSC101 origins are used as a stable three-plasmid system [2]. The copy number influences the amount of protein produced by the cell and plays a crucial role in our design, especially for the bandpass filter. Depending on the function of a particular protein in our system we had to evaluate on which plasmid the corresponding gene should be cloned.

In the xylene-responsive system we included an artificial degradation pathway (xylWCMABN) so that we could establish a xylene gradient. For this purpose the plasmid pCK04AxylR was added [3]. To avoid incompatibilities of plasmids we adapted the rest of our system and changed the composition of the genes on each vector compared to the AlcR system.

For proof of concept of the bandpass filter, we also constructed a system with AraC as an arabinose-dependent sensor. Here we again change the plasmid design in order to match the requirements of the test system. Therefore we introduced a plasmid (pSB4C5) containing the araC regulator gene and the degradation pathway for arabinose, araBAD. Since AraC is activating PBAD upon sensing arabinose, the design for the other two plasmids could be adapted from the design of the xylene system. Only Pu promoters were exchanged with PBAD.

pSB6A5

Figure 1: Improvement of the plasmid pSB6A1 to pSB6A5

The pSB6A5 plasmid we constructed by reducing the size of the antibotic (Ampicillin) and origin of replication (pMB1) casettes of pSB6A1 to a minimum and by introducing terminators around the multiple cloning site. PMB1 is a medium copy orign with about 15-20 copies per cell. For the characterization of pSB6A5 click here


Cloning strategy

General procedure

Figure 1: Cloning strategy for SmoColi


For cloning our parts we tried to follow the strategies proposed in the registry of standard biological parts [4] as much as possible . The general cloning scheme was performed as follows:

  • If available, genes and promoters in SmoColi were obtained from the iGEM spring 2011 distribution kit. A codon-optimized version of alcR and Ptet-lacIM1 were synthesized. Palc- and PU-promoters were obtained by PCR.
  • After isolation of the DNA, ribosome binding sites and prefix (5' gaattcgcggccgcttctagag 3') respectively suffix (5' tactagtagcggccgctgcag 3') were added to the gene by polymerase chain reaction. The PCR products were purified and afterwards digested with XbaI-PstI.
  • Plasmid vectors containing the corresponding promoter were linearized by SpeI-PstI and the XbaI-PstI fragment containing the gene of interest was ligated into the backbone.
  • In a next step we isolated a EcoRI-SpeI fragment with promoter, ribosome binding site and gene and inserted it into a EcoRI-XbaI cut vector containing a transcriptional terminator.
  • In the end all the constructed parts were assembled on the corresponding vectors for the final SmoColi system. Some parts (especially lacI in an actively expressed form) appeared to be negatively selected by E.coli. So we had to assemble the parts in a way that lacI was always repressed.


Sources of genes and promoters

Table 4: Promoters of SmoColi: source and final constructs of the different used promoters
Table 3: Genes of SmoColi: source and final constructs of the different used genes


Cloning successes and problems

All parts of the system were successfully assembled by this strategy, except for lacI and cI under control of the Tet promoter. Whenever we were sequencing a clone of either of those constructs, we always found protein inactivating mutations within the primer annealing part - either being deletions of the Shine-Dalgarno sequence of the RBS or frame shift mutations within the first bases of the coding regions. We first believed the problem to lie in the synthesis of the very long oligonucleotides, for adding the whole RBS and prefix in front of the genes. But also performing a whole plasmid PCR with short primers did not solve the problem and we still only got non-protein-generating sequences. We believe this to be due to lethality of high overexpression levels of LacI or CI, leading to a selection for clones mutated in a way that lacI or cI is not expressed. Thus one always has to make sure to clone lacI or cI behind downregulated promoters, for example for PTet you have to make sure that there is TetR present in the cell. Those problems unforunately delayed the construction of the complete system to only shortly before Wikifreeze, thus we hope to produce as many results as possible till the Jamboree.

Choice and design of ribosome binding sites

Table 5: Different ribosome binding sites and their estimated strengths which are included in our design. The strengths of the sequences were estimated with a RBS strength calculator [7]. In the last column it is listed in front of which genes a particular RBS was added.

Another important role in the synthesis of proteins is played by the ribosome binding site (RBS), the location where the ribosomes are bound to the mRNA at the initiation of the translation process. The ribosome binding sites which we included in our system were designed in several different ways:

  • For the bandpass filter we implemented the ones which are also used for the plasmids in [5].
  • For the other parts we either tried to use naturally occurring ribosome binding sites or took specific ones from the Anderson library of ribosome binding sites [6].

The strength of all the ribosome binding sites used was estimated with a RBS calculator. Although the efficiency of protein synthesis is not directly proportional to the estimated values, they can still indicate whether a certain RBS is more or less strong. Below you can find a list of the different ribosome binding sites used, their estimated binding strengths and in front of which genes they were put.

References

[1] [http://openwetware.org/wiki/Arking:JCAOligoTutorial8 OpenWetWare Arking: JCAOligoTutorial8, 0 Jul 2008, 04:32 UTC. 21 Sep 2011, 01:32]

[2] [http://www.springerlink.com/content/3fj1xxl9p42kx8l5/ Karl Friehs: Plasmid Copy Number and Plasmid Stability, Advances in Biochemical Engineering/Biotechnology, 2004, 86: 22-192]

[3] [http://aem.asm.org/cgi/content/abstract/64/2/748 Sven Panke, Juan M. Sánchez-Romero, and Víctor de Lorenzo: Engineering of Quasi-Natural Pseudomonas putida Strains for Toluene Metabolism through an ortho-Cleavage Degradation Pathway, Appl Environ Microbiol, February 1998, 64: 748-751]

[4] [http://partsregistry.org/Help:Contents Registry of Standard Biological Parts Help:contents 21 Sep 2011, 02:59]

[5] [http://www.nature.com/nature/journal/v434/n7037/full/nature03461.html Subhayu Basu, Yoram Gerchman1, Cynthia H. Collins, Frances H. Arnold & Ron Weiss: A synthetic multicellular system for programmed pattern formation, Nature, 2005, 434: 1130-11342]

[6] [http://partsregistry.org/Ribosome_Binding_Sites/Prokaryotic/Constitutive/Anderson J. Christopher Anderson Ribosome Binding Sites/Prokaryotic/Constitutive/Community Collection Registry of Standard Biological Parts, 21 Sep 2011, 08:49]

Back to iGEM Our Sponsors
ETHZ-BASF.png ETH Zurich Logo.png ETHZ-Lonza.png ETHZ-Merck Serono.png
ETHZ-Novartis.png ETHZ-Roche.png ETHZ-Syngenta.png DSM MasterLogo.png