Team:KIT-Kyoto/Notebook/LabNote/DIAP2-MALT9

(Difference between revisions)

Home > Notebook > Lab Note > September	Language：English/Japanese

1st, September

Member

Takeda

Again different annealing conditions were tested.

PCR reaction 10 µM Primer F 1.5 µl 10 µM Primer R 1.5 µl Template DNA 1 µl 10 x PCR Buffer 5 µl dNTPs 5 µl MgSO4 2 µl or 4 µl ddH2O 33 µl or 31 µl KOD+ polymelase 1 µl   total 50 µl

Cycle Pre-Denature 94°C 2min   Denature 94°C 15sec 35 Cyle Anneling 50.5°C 30sec Extension 68°C 100sec End 4°C keep

PCR products were applied to the agarose gel electrophoresis.

Results

Image of the agarose gel.

Lane 1；DNA size marker（1 Kbp ladder）
Lanes 2；DIAP2 cDNA
Amplified DNA fragments were barely detectable for the DIAP2.

5th, September

Member

Yokoigawa, Takeda

The PCR products for DIAP2 was treated wit phenol-chloroform and then digested with the XhoI for 20 hours at 37°C.

DIAP2

PCR reaction in ddH2O	44 μl
10 x H Buffer	5 μl
XhoⅠ	1 μl
	total 50 μl

6th, September

Member

Yokoigawa, Takeda

The PCR products for DIAP2 was treated wit phenol-chloroform and then digested with the XbaI for 20 hours at 37°C.

DIAP2

PCR reaction in ddH2O	44 μl
10 x M Buffer	5 μl
XbaⅠ	1 μl
	total 50 μl

7th, September

Member

Yokoigawa, Takeda

The restriction enzyme-digested PCR fragments and pUAST-flag DNA were extracted from the agarose gel by [http://www.qiagen.com/products/dnacleanup/gelpcrsicleanupsystems/qiaquickgelextractionkit.aspx QIAquick Gel Extraction Kit].

Results

PCR products for DIAP2 was not successfully recovered from the agarose gel.

12nd, September

Member

Matsunami, Yokoigawa

To amplify DIAP2 cDNA, PCR reactions were carried out by using the following primers and under the following conditions.

F primer GCTTCTCGATTGACGGAGCTGGGCATGGAGCT

Tm value　　　　62 °C

R primer GCCGTCTAGATCACGAAAGGAACGTGCGCA

Tm value　　　　66.4°C

amplicon size　　1514 bp

PCR reaction 10 µM Primer F 1.5 µl 10 µM Primer R 1.5 µl Template DNA 1 µl 10 x PCR Buffer 5 µl dNTPs 5 µl MgSO4 2 µl ddH2O 33 µl KOD+ polymelase 1 µl   total 50 µl

Cycle Pre-Denature 94°C 2min   Denature 94°C 15sec 35 Cycle Anneling 50.5°C 30sec Extension 68°C 1min40sec End 4°C keep

Again different annealing conditions were tested.

Annealing 50.5°C

13rd, September

Member

Matsunami, Yokoigawa

PCR products on 12th September were applied to the agarose gel electrophoresis.

Results

Image of the agarose gel.

Lane 1；DNA size marker（1 Kbp ladder）

Lanes 2 and 3；DIAP2 cDNA

Amplified DNA fragments were barely detectable for the DIAP2.

14th, September

Members

Matsunami,Yokoigawa

To amplify API2-MALT1 cDNA and, PCR reactions were carried out by using the following primers and under the following conditions.

F primer GCCGCTCGAGACATAGTAGAAAACAGCAT

Tm value　　　　57.7 °C

R primer GCCGGCTAGCTCATTTTTCAGAAATTCTGA

Tm value　　　　56.5 °C

amplicon size　　3131 bp

PCR reaction 10 µM Primer F 0.4 µl 10 µM Primer R 0.4 µl Template DNA 1 µl 10 x Ex Taq Buffer 2 µl Takara Ex Taq 0.1 µl 2.0 mM dNTPs 2 µl ddH2O 14.1 µl   total 20 µl

Cycle Pre-Denature 94°C 2min   Denature 94°C 30sec 37 Cycle Anneling 51.5°C 30sec Extension 72°C 3min20sec +Extension 72°C 10min   End 4°C keep

PCR products were applied to the agarose gel electrophoresis.

Results

Image of the agarose gel.

Lane 1；DNA size marker（1 Kbp ladder）

Lanes 2 and 3；API2-MALT1 cDNA

No PCR product was detected for API2-MALT1.

15th, September

Members

Matsunami,Yokoigawa

To amplify API2-MALT1 cDNA and DIAP2 cDNA, PCR reactions were carried out by using under the following conditions.

API2-MALT1

PCR reaction 10 µM Primer F 0.4 µl 10 µM Primer R 0.4 µl Template DNA 1 µl 10 x Ex Taq Buffer 2 µl Takara Ex Taq 0.1 µl 2.0 mM dNTPs 2 µl ddH2O 14.1 µl   total 20 µl

Cycle Pre-Denature 94°C 2min   Denature 94°C 30sec 37 Cycle Anneling 53°C 30sec Extension 72°C 3min20sec +Extension 72°C 10min   End 4°C keep

DIAP2

PCR reaction 10 µM Primer F 1.5 µl 10 µM Primer R 1.5 µl Template DNA 1 µl 10 x PCR Buffer for KOD Plus 5 µl dNTPs 5 µl MgSO4 2 µl ddH2O 33 µl KOD Plus 1 µl   total 50 µl

Cycle Pre-Denature 94°C 2min   Denature 94°C 15sec 35 Cycle Anneling 50.5°C 30sec Extension 68°C 1min 40sec End 4°C keep

PCR products were applied to the agarose gel electrophoresis.

The PCR products for DIAP2 was treated with phenol-chloroform and then digested with the XhoI for 20 hours at 37°C.

DIAP2

PCR products in ddH2O	44 µl
10 x H Buffer	5 µl
XhoⅠ	1 µl
	total 50 µl

Results

Image of the agarose gel.

Lane 1；DNA size marker（1 Kbp ladder）

Lanes 2~5；DIAP2 cDNA

Lane 6~8；API2-MALT1 cDNA

Amplified DNA fragments were barely detectable for the DIAP2.

Size of the amplified fragments for API2-MALT1 was different from the expected size

16th, September

Members

Matsunami,Yokoigawa

The PCR products for DIAP2 was treated with phenol-chloroform and then digested with the XbaI for 20 hours at 37°C.

DIAP2

PCR products in ddH2O	44 µl
10 x M Buffer	5 µl
XbaⅠ	1 µl
	total 50 µl

17th, September

Members

Matsunami,Yokoigawa

The restriction enzyme-digested PCR fragments were extracted from the agarose gel by [http://www.qiagen.com/products/dnacleanup/gelpcrsicleanupsystems/qiaquickgelextractionkit.aspx|QIAquick Gel Extraction Kit].

Results

Image of agarose gel.

PCR products for DIAP2 was not successfully recovered from the agarose gel.

18th, September

Member

Matsunami

I have streaked E.coli DH5 alpha on LB plate and incubated for 16h.

19th, September

Member

Matsunami

I have picked a single colony up, transferred it into 250 ml of SOB medium in a flask.

I have incubated it at 18°C with shaking.

21st, September

Member

Matsunami

1.SOB medium in a flask was quantified by measuring the absorbance at OD600.

2. I have repeated the PCR reactions to amplify DIAP2 cDNA under the same conditions as those carried out on 12th September.

PCR reaction 10 µM Primer F 1.5 µl 10 µM Primer R 1.5 µl Template DNA 1 µl 10 x PCR Buffer 5 µl dNTPs 5 µl MgSO4 2 µl ddH2O 33 µl KOD+ polymelase 1 µl   total 50 µl

Cycle Pre-Denature 94°C 2min   Denature 94°C 15sec 35 Cycle Anneling 50.5°C 30sec Extension 68°C 1kb/min End 4°C keep

Amplified DNA fragments were detectable for the DIAP2.

The PCR products for DIAP2 was treated with phenol-chloroform and then digested with the XhoI for 20 hours at 37°C.

DIAP2

PCR products in ddH2O	44 µl
10 x H Buffer	5 µl
XhoⅠ	1 µl
	total 50 µl

Results

1. The absorbance OD600 was over at 0.9.

2.Image of agarose gel.

Lane 1；DNA size marker（1 Kbp ladder）

Lanes 2~7；DIAP2 cDNA

The PCR products with the expected size (1.5 kb) were detected for DIAP2.

22nd, September

Member

Matsunami

The PCR products for DIAP2 was treated with phenol-chloroform and then digested with the XbaI for 20 hours at 37°C.

DIAP2

PCR products in ddH2O	44 µl
10 x M Buffer	5 µl
XbaⅠ	1 µl
	total 50 µl

23rd, September

Member

Matsunami

The restriction enzyme-digested PCR fragments were extracted from the agarose gel by [http://www.qiagen.com/products/dnacleanup/gelpcrsicleanupsystems/qiaquickgelextractionkit.aspx|QIAquick Gel Extraction Kit].

Results

Image of agarose gel.

PCR products for DIAP2 was not successfully recovered from the agarose gel.

25th, September

Member

Matsunami

I have picked a single colony up, transferred it into 250 ml of SOB medium in a flask.

I have incubated it at 18°C with shaking.

27th, September

Member

Matsunami

I have made competent cell DH5 alpha.

Results

Competency was very low.