"
Team:Edinburgh/Collaboration
From 2011.igem.org
[This page might need to be folded into the data page when we make one.]
iGEM teams have always been a highly visible part of the synthetic biology community, and an important part of iGEM is contributing to that community. Thus, the relationship between our project and the projects of other teams, past and present, is of the highest importance.
Contents |
Cooperation with Trieste
Like us, Trieste's team this year are using the BioBrick <partinfo>BBa_K392008</partinfo>. This part by Osaka 2010 encodes a cellulase, β-glucosidase, from the bacterium Cellulomonas fimi. It is known to work in the lab of Chris French (Edinburgh's supervisor).
Chris French sent Trieste a copy of the plasmid, however they reported some sequence errors and asked us for comments. We sequenced the gene independently and discovered that an apparent frameshift is present near the start of the BioBrick. This very same "frameshift" was seen in Trieste's sequencing results.
Since a part with an early frameshift cannot possibly work, but the part does work, we looked for an explanation. Some 220 bases into the part, a second ATG codon is found. This codon is in-frame and there is a plausible ribosome binding site (containing "gaagga") just upstream of it. We therefore believe that this second ATG is the true start codon. The RBS would explain why the part can be expressed and work.
> BBa_K392008 Part-only sequence (1671 bp)
atgggcgaccggttccagcaggccggtcgcccacgccgccgcggcccggcgagggccgtt
aaccgtaccggtcaagaagacgcgtcgacggggtcgagggagcggtcccacgcgtgtatc
gtatcgtttcgacaccgccacccggccaccgggcacgcaccggggacgcagcagtccccg
ccccggccaccccctgtcaccgaaacccgaaggaccctcatgaccaccacgcgcccctcg
[rest omitted]
Indeed, the most recent published sequence of C. fimi β-glucosidase (labelled as such by Expasy though NCBI calls it a β-galactosidase) starts at the 2nd ATG codon of K392008.
We passed this information on to the Trieste team, who agreed that it is a likely explanation.
In addition to this, at the request of the Trieste team we sent details of an assay that can be used to test for activity of this β-glucosidase. This assay involves 4-methylumbelliferyl-β-D-glucuronide, which is cleaved by β-glucosidase to yield a fluorescent product visible under long-wave blue light.
Ice Nucleation Protein
We gratefully acknowledge UC Davis 2009, who synthesised an E. coli optimised version of Pseudomonas syringae Ice Nucleation Protein. We were delighted to discover that the part we received from the Registry had the correct sequence.
We also acknowledge the help of this year's Leuven team, who also used Ice Nucleation Protein, and suggested alternative sources in case we needed them.
Updating the Registry
The hub of our community's collective experience is the Parts Registry. During our work, we have discovered some useful information about several parts in the Registry. We have entered this information in the "experience" section of the relevant pages.
K415151
This part by MIT 2010 is supposed to encode a fusion of the pVIII protein to a GR1 zipper. However, we noticed that the official verification sequencing carried out by the Registry did not match the expected sequence and did not contain a prefix or suffix.
We tried to determine what the sequence actually is, and discovered that it is a fragment of the E. coli main genome. This fragment naturally has EcoRI and PstI sites at its ends. It has evidently been cut with those enzymes and has somehow become inserted into pSB1C3 via those sites. This naturally wipes out the XbaI and SpeI sites, explaining their absence.
This information has been added to the Registry on the relevant experience page.
K392008
As mentioned above, Trieste and Edinburgh cooperated around the use of this part from Osaka 2010, and came to suspect that the second ATG present in the sequence is the real start codon.
In addition, there are some other discrepancies between the published sequence and the physical K392008 as well.
This information has been added to the Registry on the relevant experience page.
