Team:EPF-Lausanne/Our Project/T7 promoter variants/t7prom

From 2011.igem.org

(Difference between revisions)
(→Introduction)
(→List and Sequences of Variants)
Line 14: Line 14:
=== List and Sequences of Variants ===
=== List and Sequences of Variants ===
 +
===Non-random T7 promoter variants===
 +
Variants without additional lac operator (constitutive):
 +
{|
 +
|-
 +
| Parts Registry Number
 +
| Strength
 +
| Mutation Position
 +
| Sequence
 +
|-
 +
| [http://partsregistry.org/Part:BBa_K613001 K613001]
 +
| Wildtype
 +
| None
 +
| TAATACGACTCACTATAGGGAGA
 +
|-
 +
|}
 +
 +
[http://partsregistry.org/Part:BBa_K613002 K613002]
 +
 +
[http://partsregistry.org/Part:BBa_K613003 K613003]
 +
 +
[http://partsregistry.org/Part:BBa_K613004 K613004]
 +
 +
[http://partsregistry.org/Part:BBa_K613005 K613005]
 +
 +
[http://partsregistry.org/Part:BBa_K613006 K613006]
 +
 +
 +
Variants with additional lac operator (LacI repressed):
 +
 +
[http://partsregistry.org/Part:BBa_K613007 K613007]
 +
 +
[http://partsregistry.org/Part:BBa_K613008 K613008]
 +
 +
[http://partsregistry.org/Part:BBa_K613009 K613009]
 +
 +
[http://partsregistry.org/Part:BBa_K613010 K613010]
 +
 +
[http://partsregistry.org/Part:BBa_K613011 K613011]
 +
 +
[http://partsregistry.org/Part:BBa_K613012 K613012]
=== Characterization of Designed Variants ===
=== Characterization of Designed Variants ===

Revision as of 19:58, 21 September 2011

Retrieved from "http://2011.igem.org/Team:EPF-Lausanne/Our_Project/T7_promoter_variants/t7prom"