"

From 2011.igem.org

---

Protocols

This page lists all the protocols used in our project. We have classified them into five main categories as follow.

---

Gene Guard

Genome integration

-Grow a culture of CRIM helper plasmid containing cells and make them competent.

-Transform competent cells with CRIM plasmid.

-After transformation, suspend cells in SOC without ampicillin.

-Incubate at 37°C for one hour.

-Incubate at 42°C for 30 minutes.

-Plate cells on agar plates containing kanamycin.

Soil survivability

- Grow cultures of E. coli expressing your favourite reporter gene

- Autoclave soil in a 100ml Schott bottle to make it sterile

- Collect non-sterile soil from the same source in another bottle

- Fill 1.5ml Eppendorf tubes with about 1ml of sterile or non-sterile soil

- Hole-punch filter paper to create small discs that you subsequently autoclave

- Dip the filter papers into your bacterial media and put one filter paper in each Eppendorf

- For the negative control, put non-inoculated filter discs into Eppendorfs containing non-sterile soil

- Keep the Eppendorfs at room temperature

- Each week, grow up a sample each from the sterile soil, non-sterile soil and control Eppendorfs. For this, remove the filter disc and put it in 1ml of LB containing the selective antibiotic. Grow for three or four hours into exponential phase, then plate about 50 ul of each culture onto an LB plate containing the selective antibiotic. Grow overnight and check for fluorescence the next day using a blue light box or UV imager (or whatever else is appropriate for the reporter you are using)

To test for presence of the insert:
- Pick a colony from each plate (or several if you can see different colony morphologies on one plate) and grow them up in LB containing selective antibiotic

-Perform a miniprep on each of the cultures (see our cloning protocols section)

- Digest with EcoRI and PstI (or whatever other restriction enzymes you can use to remove your reporter gene from its vector) for 90 minutes according to the manufacturer's instructions, then either heat inactivate or immediately run on a 1% agarose gel

To determine bacterial species
-Set up a colony PCR (see cloning protocols) with the following primers:

515F (GTGCCAGCMGCCGCGGTAA, M=A or C)

1492R (GGYTACCTTGTTACGACTT, Y=C or T)

27F (GGCTACCTTGTTACGACTT, Y= Universal 27F-1 27F-2 GGCTACCTTGTTACGACTT AGAGTTTGATCCTGGCTCAG Bacteria

---