PCR Conditions and Primers of Registry Parts

Please fill out for every PCR reaction done on a registry part (both new and old).

**PCR Conditions and Primers of Registry Parts**
Amplification Success (S, M, N)	Template Part #	Template Form (M, C, P)	Template Source	Forward Primer Name	Reverse Primer Name	Annealing Temperature (Celsius)	Extension Time (seconds)	Percent DMSO	Polymerase Used	Forward Primer (5'->3')	Reverse Primer (5'->3')	Additional Notes
S	BBa_XYZ001	M	Synthesized Gene	EX_Decarb_F	RedDecarb_SP_2	60	30	0	Phusion	GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA	CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG	Original reverse primer was missing extra nucleotides at end, so amplification worked, cloning didn't
Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill

LEGEND

Amplification Success (S, M, N): Was the amplification successful.
- S = Single Band at Desired Size
- M = Multiple Bands, but one at desired length
- N = No band at desired length
Template Part #: The Registry Number of the Part being amplified from
Template Form: The source form of the template DNA
- Miniprep (M)
- Colony (C)
- PCR Product (P)
Template Source: Where the template is originally from, such as 2011 Parts Kits, Synthesized Gene, Genomic, etc
Forward Primer (5'->3'): Full sequence of the Forward primer used
Reverse Primer (5'->3'): Full sequence of the Reverse primer used
Annealing Temperature (Celsius): The annealing temperature used in the PCR reaction
Extension Time (seconds): The extension time used in the PCR reaction
Percent DMSO: Was DMSO added, if not 0, if so at what %
Polymerase Used: Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc)
Primer Name: The name of the primer ordered
Additional Notes: Any additional relevant information

Sortable and collapsible table
Alphabetic	Numeric	Date	Unsortable
d	20	2008-11-24	This
b	8	2004-03-01	column
a	6	1979-07-23	cannot
c	4.2	1492-12-08	be
e	0	1601-08-13	sorted.