EVERYONE PLEASE ENTER AND FILL OUT THE TABLE

For info on [http://en.wikipedia.org/wiki/Help:Table#Sorting Wiki Tables]

EXAMPLE TABLE (DO NOT MODIFY)

Sortable and collapsible table
Alphabetic	Numeric	Date	Unsortable
d	20	2008-11-24	This
b	8	2004-03-01	column
a	6	1979-07-23	cannot
c	4.2	1492-12-08	be
e	0	1601-08-13	sorted.

LEGEND:

Amplification Success (S, M, N): Was the amplification successful.
- S = Single Band at Desired Size
- M = Multiple Bands, but one at desired length
- N = No band at desired length
Template Part #: The Registry Number of the Part being amplified from
Template Form: The source form of the template DNA
- Miniprep (M)
- Colony (C)
- PCR Product (P)
Template Source: Where the template is originally from, such as 2011 Parts Kits, Synthesized Gene, Genomic, etc
Forward Primer (5'->3'): Full sequence of the Forward primer used
Reverse Primer (5'->3'): Full sequence of the Reverse primer used
Annealing Temperature (Celsius): The annealing temperature used in the PCR reaction
Extension Time (seconds): The extension time used in the PCR reaction
Percent DMSO: Was DMSO added, if not 0, if so at what %
Polymerase Used: Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc)
Primer Name: The name of the primer ordered
Additional Notes: Any additional relevant information

Amplification Success (S, M, N)	Template Part #	Template Form (M, C, P)	Template Source	Forward Primer Name	Reverse Primer Name	Annealing Temperature (Celsius)	Extension Time (seconds)	Percent DMSO	Polymerase Used	Forward Primer (5'->3')	Reverse Primer (5'->3')	Additional Notes
S	TBD	M	Synthesized Gene	EX_Decarb_F	RedDecarb_SP_2	60	30	0	Phusion	GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA	CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG	Original reverse primer was missing extra nucleotides at end, so amplification worked, cloning didn't
Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill