Team:KIT-Kyoto/Notebook/LabNote/GFPMLF9

Home > Notebook > Lab Note > September	Language：English/Japanese

1st, September

Member

Nakagawa

1.Using [http://www.qiagen.com/products/dnacleanup/gelpcrsicleanupsystems/qiaquickgelextractionkit.aspx|QIAquick Gel Extraction Kit] and extracted DNA of pSB1C3 from the gel.

2.DNA bands in the agarose gel.

After extracting DNA,I measured 5µl ,and diluted it for 20 times.

And I measured its density.

3.PCR reaction was carried out by using primers designed on August 30th. The reaction conditions are summarized below.

PCR reaction 10 µM Primer F 1.5 µl 10 µM Primer R 1.5 µl BBa_E0240 1 µl 10 x PCR Buffer for KOD Plus 5 µl dNTPs 4 µl MgSO4 4 µl ddH2O 32 µl KOD Plus 1 µl   total 50 µl

Cycle Pre-Denature 95°C 30sec   Denature 95°C 30sec 30 Cycle Anneling 48.5°C 1min Extension 68°C 1kb/min End 4°C keep

Results

2.Image of the agarose gel.

You can see DNA band at around 2kbp.

density(ng/µl)

1	19.0
2	13.0
3	19.0
4	22.0
5	16.0
ave.	17.8

2nd, September

Member

Nakagawa

Isolate BBa_E0240 by phenol-chloroform treatment,Agarose gel electrophoresis and carried out to detect the PCR products.

I digested PCR products with the following restriction enzymes (at 37°C for 16 hours).

ddH2O	2 µl
BBa_E0240	50 µl
EcoRⅠ	1 µl
PstⅠ	1 µl
10 x H Buffer	6 µl
	total 60 µl

Results

2.Image of the agarose gel.

I can see BBa_E0240 band at the correct place.And the density was enough to watch it.

3rd,September

Member

Nakagawa

Using [http://www.qiagen.com/products/dnacleanup/gelpcrsicleanupsystems/qiaquickgelextractionkit.aspx|QIAquick Gel Extraction Kit] and extracted DNA of pSB1C3 from the gel.

Results

5th,September

Member

Nakagawa

Ligate BBa_E0240.which doesn’t have ATG codons and pSB1C3

I have transformed E. coli DH5 alpha with it.

Before I made BBa_E0240.which doesn’t have ATG codons and pSB1C3.

The densities are 19ng/µl and 25ng/µl.

DNA samples were digested by the following restriction enzymes at 37 ℃ for 30 min.

BBa_E0240	0.5 µl
pSB1C3	0.5 µl
10 x Buffer	2.5 µl
F4 ligase	0.5 µl
ddH2O	1.0 µl
	total 5 µl

After ligate them, I have transformed E. coli DH5 alpha with it.

Results

There aren’t any colonies on the plate.

However I heared the success probability is very low, so next time I want to be careful about the density.

6th,September

Member

Yoshimura,Nakagawa

1.Ligate BBa_E0240.which doesn’t have ATG codons and pSB1C3

DNA samples were digested by the following restriction enzymes at 37 ℃ for 30 min

insert	0.5 µl
vector	0.5 µl
10 x Buffer	2.5 µl
F4 ligase	0.5 µl
ddH2O	1.0 µl
	total 5 µl

However, I ligated them with this density ratio (bector: insert=1:9)

After ligate them, I have transformed E. coli DH5 alpha with it.

2. We attached restriction enzyme site of EcoRⅠand XbaⅠto the Flag-tag dMLF from pUAST Flag-tag dMLF.

We isolated Flag-tag dMLF from pUAST Flag-tag dMLF.

Results

1.There are 4 colonies on the LB plate.

2.F：AAAGAATTCAAATCTAGAAAAATGGACTACAAGGACGA

　　　　　 EcoRⅠ　　XbaⅠ

Tm value:72.14℃ 38bases

R：AAACTGCAGAAAACTAGTAAATACCCTACTTCTTCTTGCC

　　　　 PstⅠ　　　SpeⅠ

Tm value:72.16℃　40bases

7th.September

Member

Nakagawa

I did pre-culture of yesterday colonies and pSB1C3.

PCR and restriction enzyme with MLF

PCR条件 10 µM GFP Primer F 1.5 µl 10 µM GFP Primer R 1.5 µl BBa_E0240 1 µl 10 x PCR Buffer for KOD Plus 5 µl dNTPs 4 µl MgSO4 4 µl ddH2O 32 µl KOD Plus 1 µl   total 50 µl

Cycle条件 Pre-Denature 95°C 30sec   Denature 95°C 30sec 30 Cycle Anneling 50°C 1min Extension 68°C 1min End 4°C keep

After that, I isolated MLF with restriction enzyme.

DNA samples were digested by the following restriction enzymes at 37 ℃ for 16 hours.

ddH2O	2 µl
Flag tag dMLF	50 µl
EcoRⅠ	1 µl
PstⅠ	1 µl
10 x H Buffer	6 µl
	total 60 µl

8th,September

Member

Nakagawa

Using [http://www.qiagen.com/products/dnacleanup/gelpcrsicleanupsystems/qiaquickgelextractionkit.aspx|QIAquick Gel Extraction Kit] and extracted DNA of Flag tag dMLF from the gel.

Isolatioe pSB1C3 by the alkaline-lysis method by phenol-chloroform treatment, DNA was digested with the following restriction enzymes (30 min at 37℃).

I digested the DNA of pSB1C3 with the following restriction enzymes (at 37°C for 16 hours).

ddH2O	2 µl
pSB1C3	50 µl
EcoRⅠ	1 µl
PstⅠ	1 µl
10 x H Buffer	6 µl
	total 60 µl

Results

We cannot see any bands of MLF from the gel.

So, we are effort to ligate with pSB1C3 and BBa_E0240.

9th,September

Member

Nakagawa

I planned to give efficiency of the ligation by giving rise to the density of GFP and vector by ethanol precipitating

Results

I failed to rise the densities of vector and the DNA of insert.

We lost DNA In the middle of ethanol precipitation.

12th,September

Members

Yoshimura, Nakagawa

1.We amplified the Flag-MLF by using primer which was made on September 6th.

We did PCR reaction with following conditions.

PCR reaction(1) 10 µM Primer F 1.5 µl 10 µM Primer R 1.5 µl Template DNA 1 µl 10 x PCR Buffer for KOD Plus 5 µl dNTPs 4 µl MgSO4 4 µl ddH2O 32 µl KOD Plus 1 µl   total 50 µl

Cycle Pre-Denature 94°C 2min   Denature 94°C 15sec 35 Cycle Anneling 55°C 30sec Extension 68°C 1min 20sec End 4°C keep

PCR reaction(2) 10 µM Primer F 1.5 µl 10 µM Primer R 1.5 µl Template DNA 1 µl 10 x PCR Buffer for KOD Plus 5 µl dNTPs 4 µl MgSO4 2 µl ddH2O 34 µl KOD Plus 1 µl   total 50 µl

Cycle Pre-Denature 94°C 2min   Denature 94°C 15sec 35 Cycle Anneling 55°C 30sec Extension 68°C 1min 20sec End 4°C keep

We collected each sample and kept them in -20°C.

2.Pre-culture of E.coli(DH5α)which contains pSB1C3.

I tried doing PCR reaction with following conditions with BBa_E0240 again.

PCR reaction 10 µM Primer F 1.5 µl 10 µM Primer R 1.5 µl GFP 1 µl 10 x PCR Buffer for KOD Plus 5 µl dNTPs 4 µl MgSO4 4 µl ddH2O 32 µl KOD Plus 1 µl   total 50 µl

Cycle Pre-Denature 95°C 30sec   Denature 95°C 30sec 30 Cycle Anneling 48.5°C 1min Extension 68°C 1kb/min End 4°C keep

I isolated pSB1C3 by phenol-chloroform treatment .I digested DNA with the following restriction enzymes (30 minutes at 37°C).

ddH2O	2 µl
BBa_E0240	50 µl
EcoRⅠ	1 µl
PstⅠ	1 µl
10 x H Buffer	6 µl
	total 60 µl

Results

The E.coli (DH5α) which contains pSB1C3 was increased, but there are some colonies which doesn’t correct color.

Possibly deterioration may begin in plate in itself.

The DNA of PCR reaction increased next day.

13th,September

Member

Yoshimura, Nakagawa

1.We carried out agarose gel electrophoresis to detect the PCR products.

2.We amplified Flag-tag dMLF by using the primer which I manufactured on 6th September.

Restriction enzyme processing.

This is because after examining a sequence of Flag-tag dMLF, a restriction enzyme site of PstI and XbaI was seen.

So, I examined whether PCR product of Flag-tag dMLF is cut by PstI and XbaI.

(1)

MilliQ	6.5 µl
Flag-tag dMLF	20 µl
PstⅠ	0.5 µl
10 x H Buffer	3 µl
	total 30 µl

(2)

MilliQ	6.5 µl
Flag-tag dMLF	20 µl
XbaⅠ	0.5 µl
10 x M Buffer	3 µl
	total 30 µl

(3)

MilliQ	6 µl
Flag-tag dMLF	20 µl
PstⅠ	0.5 µl
XbaⅠ	0.5 µl
10 x M Buffer	3 µl
	total 30 µl

After incubate it in 37°C for 50 minutes, I performed electrophoresis with agarose gel.

Photograph after the electrophoresis.

3.To amplify Flag-tag dMLF cDNA, PCR reactions were carried out under the following conditions.

PCR reaction 10 µM Primer F 1.5 µl 10 µM Primer R 1.5 µl Template DNA 1 µl 10 x PCR Buffer for KOD Plus 5 µl dNTPs 4 µl MgSO4 4 µl ddH2O 32 µl KOD Plus 1 µl   total 50 µl

Cycle Pre-Denature 94°C 2min   Denature 94°C 15sec 35 Cycle Anneling 55°C 30sec Extension 68°C 1min 20sec End 4°C keep

We collected each sample and kept them in -20°C.

Results

1.Image of the agarose gel.

2.Images of the agarose gel.

:

Flag-tag dMLF aren’t cut by restriction enzyme of PstI and XbaI.

A marker did not enough to drift.

14th,September

Members

Yoshimura

1.We carried out agarose gel electrophoresis to detect the PCR products.

2.I extracted GFP, DNA of the vector from gel using [http://www.qiagen.com/products/dnacleanup/gelpcrsicleanupsystems/qiaquickgelextractionkit.aspx|QIAquick Gel Extraction Kit].

Results 1.Image of the agarose gel.

After doubling the density of gel, a marker did not drift.

I will decide to perform it with 2% of agarose gel about the electrophoresis of Flag-tag MLF in future.

2.I measured the density with an absorbance meter afterwards.

GFP

1	0.158
2	0.147
3	0.160
4	0.159
5	0.158
ave.	0.156

pSB1C3

<tr><td>

1	0.029
2	0.021
3	0.028
4	0.022
5	0.025
ave.	0.025

left:GFP　right:pSB1C3

<IMG src=" " width="240px" height="280px" border="0"> </BODY></HTML>

The BBa_E0240 succeeded in the extraction from gel and recorded 156ng/µl by the measurement with the absorbance meter and the pSB1C3 became 25ng/µl.

Therefore I decided to begin an experiment of the ligation again from the next day.