Team:Potsdam Bioware/Labjournal/May

1st Labday 12.05.2011

Preparative DNA Electrophoresis, Test Experiment 629, 654 digest

Investigators: Sascha, Jessica, Steffi, Sandrina, Nadine; introduction by Kristian, Tobias, Tim

Aim: get used to the lab

Time: 13:40

Method:

Samples digested with AscI and NheI from Tim

vector: 629 source: Tobias; prep-type: ? ; prep-date: ; clone-no: ?

insert: 654 source: Tobias; prep-type: ? ; prep-date: ; clone-no: ?

Electrophoresis

sample preparation: 30 µl 629 (digested) + 6 µl 6x loading dye solution, 30 µl 654 (digested) + 6 µl 6x loading dye

0,5 g Agarose, 50 ml TAE (1%), 2 µl GELRED (3-6µl), at 100 Volt,running time:_?___ minutes

marker: GeneRuler ladder mix (Fermentas)

Gel Extraction

DNA excision: lane 4: 6000 bp band and 3000 bp band; lane 7: 1700 bp band

DNA purification: with Qiagen Gel Extraction Kit according to Qiagen manual (incl. isopropanol step)

Result: size estimation by eye;

lanes 3+4: plasmid was digested, small band has the expected size, two upper bands with unexpected size;

lanes 6+7: plasmid was digested; 6000 bp unexpected; 4000 bp band might correspond to expected 4140 bp band, 1700 bp band above expected 1268 bp

Conclusions:

• exact vector fragment unknown, therefore 6000 bp band and 3000 bp band were excised from lane 4, lane 7: 1700 bp band was excised;
• because of unexpected sizes marker should be compared with another marker, plasmids should be digested to yield several fragments for size control, maybe heat inactivation might help to resolve higher bands
  

Output: three plasmid fragments with 6000 bp (V1), 3000 bp (V2) and 1700 bp (I1) in 1,5 ml eppis,

stored at -20 °C, box with fragments

Ligation 629 vec frag, 654 insert

Investigators: Sascha, Jessica, Steffi, Sandrina, Nadine

Aim: create a new vector for Tim

Time: 16:30

Method:

vector: 629 source: Tobias; prep-type: ; prep-date: 12.4.2011; clone-no: ?

insert: 654 source: Tobias; prep-type: ; prep-date: 12.4.2011; clone-no: ?

Ligation: 2 µl vector, 2 µl insert, 1 µl quick ligase, 5 µl 2x quick ligase NEB, 10 min

Output: plasmid: pNoname_Tim_V1, pNoname_Tim_V2, 2 eppis labeled 'ligation', handed over to Tim

Transformation of ligation 629_vec_frag 654_insert

Investigators: Sascha, Jessica, Steffi, Sandrina, Nadine

Aim:amplification of previous ligation

Time: 16:40

Method:

ligation-samples from 12.5.11;

pNoname_Tim_V1 in BL21 (CaCl2 chemical competent, source: Tobias, date: unknown) and XL1 (CaCl2 chemical competent,

source: Tobias, date: unknown)

pNoname_Tim_V2 in BL21 (CaCl2 chemical competent, source: Tobias, date: unknown) and XL1 (CaCl2 chemical competent, source: Tobias, date: unknown)

protocol:

addition of 2 µl ligation reaction to cells in 1.5 ml Eppi,

incubation 30 min on ice,

heat shock 45 sec at 42°C,

addition of 750 µl SOC medium,

incubation at 37 °C for 45 min in Eppendorf thermomixer at 750 rpm,

centrifugation at 2000xg; for 3 min,

decandation of supernatant,

resuspension of pellet in approx. 150 µl,

plating on LB medium with 1,5 % agar, 100 µg/ml ampicillin,

storage over night at 37°C

Results and Conclusion (13.5.2011):

pNoname_Tim_V2 in BL21: 4 distinct colonies

test ligation is missing, not enough clones, pick one clone for test

digest, repeat experiment

Output four agar plates given to Tim (only one with clones)

2nd Labday 2011-05-13

Design of primers and annotation of pARW071

Investigators: Jessica, Katharina, Hanna, Nadja, Nicole

Aim: Design of primers for sequencing pARW071, annotation of pARW071

Time: 2011-05-12, 4:00 pm - 8:00 pm and 2011-05-13, 11:15 am - 12:30 am

Materials/ Software:

• Geneious Pro 5.1.7
  

• Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)
  

Method:

1. Annotation of pARW071

• Alignment of pARW071 and pDrive_Qiagen (PCR cloning vector)
  

• Alignment of pARW071 and AM943877 (Microcystis aeruginosa NIES-298 microviridin biosynthetic gene cluster, strain NIES-298)
  

2. Primer design

• melting temperature based on 4+2 method, sum has to be 56°C
  

• check specific binding using dotplot feature (parameters: low sensitivity: 10, tick at reverse complementary) of Genious Pro 5.7.1
  

• Check self-complementarity and melting temperature using Oligo Calc
  

Results:

Primer sequences

• sf_bb_1_1      ACAATTCACTGGCCGTCG
  

• sf_bb_2_1      AAGATCCTTGAGAGTTTTCG
  

• sf_bb_3_1_n   AAATTCCAACATGGATGCTG
  

• sf_bb_4_1      TAATACGACTCACTATAGGG
  

• sf_mdn_1_1    ACCAACAAATACAGAGCCAG
  

• sf_mdna_1     GGTTATTGCAGGTGGTTAG
  

• sf_mdnc_1     ATCGCTTCCCTACAGAGG
  

• sf_mdnd_1     CTCCTAACCCCACC
  

• sf_mdne_1_n  AAGGTTTTTGGGTCTTTATCG
  

• sf_mdne_2_1  CGATAAATTCTCCACAATTACC
  

• sf_mdne_3_1  AATTGAGAAAAAGCAAATAACC
  

• sf_mndb_1     GTTATTACAACTTCGTTTGG
  

pARW071 with primers and annotations

400px

Conclusion:

Primer ordering by Sigma-Aldrich

Further tasks

• Midi Prep of E. coli carrying pARW071 and pARW089
  

• Sequencing of pARW071

3rd Labday 2011-05-23

Overnight cultures of pARW071 and pARW089 carrying cells

Investigators: Jessica, Nadja, Nicole

Time: 2011-05-23, 5:30 pm - 7:30 pm

Materials:

• LB medium
  

• Ampicillin 100 µg/ ml
  

Clones:

1. pARW071 pDrive-mdnA-E, N843(Top10 cells) - clone 1; Source: Elke Dittmann; Date of plate:

2. pARW089 pDrive-mdn cluster with Aat II/ Ehe I restriction sites before and afterwards the mdnA gene (XL1O gold cells) - clone 1; Source: Elke Dittmann; Date of plate:

Method:

Inoculation of one clone each in 100 ml LB medium containing ampicillin

shaking over night at 37°C, 300 rpm, approx. 19 hours

Further tasks:

• Midiprep
  

• Sequencing of complete pARW071

• Sequencing of mdnA in pARW089

Output:2 over night cultures pARW071 in Top10 cells, pARW089 in XL10 cells

4th Labday 2011-05-24

Midiprep of pARW071 and pARW089 carrying cells

Investigators: Nadja, Nicole

Aim:

• Midiprep of pARW071 and pARW089 carrying cells
  

• Glycerol stocks of E. coli cells carrying pARW071 and pARW089
  

Time: 2011-05-24, 3:00 pm - 7:00 pm

Materials:

• Qiagen Plasmid Plus Midi Kit
  

• Glycerol
  

• over night cultures of pARW089 and pARW071 carrying cells

Method:

1. Glycerol stocks

• 700 µl of cell suspension
  

• 300 µl glycerol
  

• gently mixed and frozen by -80°C
  

2. Midiprep

• using Qiagen Plasmid Plus Midi Kit Quick-Start Protocol, Media: UP_QIAGEN_Plasmid_Plus_Midi_Kit.pdf
  

Output: DNA Eppi Tube labelled with "1" for pARW071 and "2" for pARW089, storage in pink DNA box

Further tasks:

• DNA concentration determination
  

• Sequencing of complete pARW071

• Sequencing of mdnA in pARW089

5th Labday 2011-05-25

Overnight culture of E.coli cells carrying MRC and N298 fosmids

Investigators: Nadja, Nicole

Time: 2011-05-25, 4:00 pm - 7:00 pm

Materials:

• LB medium
  

• 12.5 µg/ml Chloramphenicol
  

Method:

One clone in approx. 2 ml LB medium

• N298 fosmid (mdnB) Epi cells - plate/clone 1
  

• N298 fosmid (mdnB) Epi cells - plate/clone 2
  

• MRC fosmid (mdnJ variants) Epi cells - clone 1
  

• MRC fosmid (mdnJ variants) Epi cells - clone 1
  

shaking over night at 37°C, 300 rpm

Output:

• over night cultures

Further tasks:

• Glycerol stocks of each clone
  

6th Labday 2011-05-26

Glycerol stocks of E.coli cells carrying MRC and N298 fosmids

Investigators: Nadja, Nicole

Aim: Generating stocks for further research

Time: 2011-05-26,17:45-18:15

Materials:

• Glycerol
  

• N298 fosmid (mdnB) Epi cells - plate/clone 1
  

• MRC fosmid (mdnJ variants) Epi cells - clone 1
  

Method:

• 700 µl of cell suspension
  

• 300 µl glycerol
  

• mixed gently and frozen by -80°C
  

7th Labday 2011-05-27

Preparation of samples for sequencing

Investigators: Jessica, Nicole, Nadja

Aim: Prepare mixtures for sequencing

Time: 2011-05-27,13:45-15:45

Materials:

• Nanodrop
  

• Primers ordered previously by Sigma Aldrich --> see labday 2
  

• Isolated DNA of pARW071 and pARW089
  

Method:

1. Preparation of primer stocks

• Primers arrived dry
  

• Adding ddH2O (based on manufacture's sheet)
  

• Reached concentration 100 µM
  

2. DNA concentration determination

• Using nanodrop
  

3. Preparing sequencing mixtures

a. Dilution of DNA and primers

• Primers: needed concentration = 10 pmol/ µl, volume needed: 20 µl
  

• DNA: needed concentration = 60 ng/ µl, volume needed: 20 µl per 8 sequencing reactions
  

b. Preparation of sequencing tubes for sequencing by GATC

• For each tube one barcode, green = DNA, yellow = primer
  

• 2 tubes with DNA (pARW071 and pARW089)
  

• 12 tubes with primers (sf_mdna_1 is used for pARW071 and pARW089)
  

Results:

1. Concentration of plasmid DNA

• pARW071: 626.7 ng/ µl
  

• pARW089: 857.3 ng/ µl
  

2. Sequencing ordered by GATC

Further tasks:

• Analysis of sequencing of pARW071 and pARW089 (hopefully the results will arrive on monday)
  

• Testing PCR of the complete pARW071 and pARW089, respectively
  

• Inserting myc-tag
  

• Cloning mdnA in phagemid
  

• Cloning gene 3 in pARW089

8th Labday 2011-05-30

Searching for promotor region and primer design

Investigators: Jessica, Nicole, Sabine, Sandrina, Steffi, Nadja

Aim: Find the putative mdn promoters and design a primer (r_bb_1) which will be used for a PCR of the whole mdn

Time: 2011-05-30,15:00-17:50

Materials:

• Geneious Pro 5.1.7

• Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)
  

• Some online tools to search for the promotors:
  

1. http://linux1.softberry.com/berry.phtml?topic=bprom&group=programs&subgroup=gfindb

2. http://bioinformatics.biol.rug.nl/websoftware/ppp/ppp_start.php

3. http://genie.dartmouth.edu/scope/results.php?jobid=111290

Method:

1. Primer design

• melting temperature based on 4+2 method, sum has to be 56°C

• check specific binding using dotplot feature (parameters: low sensitivity: 10, tick at reverse complementary) of Genious Pro 5.7.1

• Check self-complementarity and melting temperature using Oligo Calc

2. Promoter search

• Application of software tools

• Annotation of pARW071

Results:

1. Primer sequence

• r_bb_1    CGACGAATTCAGATTAGGAA

2. Search for the promotors

• Search results see pdf file Media: UP_2011-05-30_PromoterSearchResults.pdf?
  

Further tasks:

• PCR of mdn

• Talk with Elke about the promoter

9th Labday 2011-05-31

Analysis of sequencing results and Primer design

Investigators: Jessica, Nicole, Sandrina, Nadja

Aim: Confirm pARW071 sequence and order primer (r_mdna_1) for PCR of mdnA of pARW089

Time: 2011-05-31,11:45-16:00

Materials:

• Geneious Pro 5.1.7

• Oligo Calc: Oligonucleotide Properties Calculator (http://www.basic.northwestern.edu/biotools/oligocalc.html)
  

Method:

1. Primer design

• melting temperature based on 4+2 method, sum has to be 56°C

• check specific binding using dotplot feature (parameters: low sensitivity: 10, tick at reverse complementary) of Genious Pro 5.7.1

• Check self-complementarity and melting temperature using Oligo Calc

2. Sequencing analysis

• Alignment of sequencing results with pARW071

Results:

1. Primer sequence

• r_mdna_1    CGGTGTAATCAAGAAAAGT

2. Sequencing analysis

• pARW071

• pARW089

• Legend: - = no mismatches; / = sequencing did not work
  

Further tasks:

• Check how serious the consequences of the found mismatches are