"
Team:Washington/Primers
From 2011.igem.org
(Difference between revisions)
(Created page with "{{Template:Team:Washington/Templates/Top}} =EVERYONE PLEASE ENTER AND FILL OUT THE TABLE= For info on [http://en.wikipedia.org/wiki/Help:Table#Sorting Wiki Tables] ==EXAMPL...") |
|||
| Line 31: | Line 31: | ||
==TABLE TO BE FILLED OUT== | ==TABLE TO BE FILLED OUT== | ||
LEGEND: | LEGEND: | ||
| + | *Amplification Success (S, M, N): Was the amplification successful. | ||
| + | **S = Single Band at Desired Size | ||
| + | **M = Multiple Bands, but one at desired length | ||
| + | **N = No band at desired length | ||
*Template Part #: The Registry Number of the Part being amplified from | *Template Part #: The Registry Number of the Part being amplified from | ||
*Template Form: The source form of the template DNA | *Template Form: The source form of the template DNA | ||
| Line 43: | Line 47: | ||
*Percent DMSO: Was DMSO added, if not 0, if so at what % | *Percent DMSO: Was DMSO added, if not 0, if so at what % | ||
*Polymerase Used: Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc) | *Polymerase Used: Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc) | ||
| - | |||
| - | |||
| - | |||
| - | |||
*Primer Name: The name of the primer ordered | *Primer Name: The name of the primer ordered | ||
*Additional Notes: Any additional relevant information | *Additional Notes: Any additional relevant information | ||
| Line 52: | Line 52: | ||
| - | {| class="wikitable sortable collapsible" border="1" cellpadding="2" | + | {| class="wikitable sortable collapsible" border="1" cellpadding="2" style="text-align: center; width: 200px;" |
|- | |- | ||
| - | ! scope="col" width=" | + | ! scope="col" | Amplification Success<br>(S, M, N) |
| - | ! scope="col" width="100pt" | Template Form (M, C, P) | + | ! scope="col" width="150pt" | Template Part # |
| + | ! scope="col" width="100pt" | Template Form<br> (M, C, P) | ||
! scope="col" width="100pt" | Template Source | ! scope="col" width="100pt" | Template Source | ||
| - | ! scope="col" width="100pt" | Forward Primer (5'->3') | + | ! scope="col" width="100pt" | Forward Primer<br> (5'->3') |
| - | ! scope="col" width="100pt" | Reverse Primer (5'->3') | + | ! scope="col" width="100pt" | Reverse Primer <br>(5'->3') |
| - | ! scope="col" width="100pt" | Annealing Temperature (Celsius) | + | ! scope="col" width="100pt" | Annealing Temperature<br> (Celsius) |
| - | ! scope="col" | Extension Time (seconds) | + | ! scope="col" | Extension Time <br>(seconds) |
! scope="col" | Percent DMSO | ! scope="col" | Percent DMSO | ||
! scope="col" | Polymerase Used | ! scope="col" | Polymerase Used | ||
| - | |||
! scope="col" class="unsortable" | Forward Primer Name | ! scope="col" class="unsortable" | Forward Primer Name | ||
! scope="col" class="unsortable" | Reverse Primer Name | ! scope="col" class="unsortable" | Reverse Primer Name | ||
! scope="col" class="unsortable" | Additional Notes | ! scope="col" class="unsortable" | Additional Notes | ||
|- | |- | ||
| - | | TBD || M || Synthesized Gene || GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA || CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG || 60 || 30 || 0 || Phusion | + | | S || TBD || M || Synthesized Gene || GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA || CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG || 60 || 30 || 0 || Phusion || EX_Decarb_F || RedDecarb_SP_2 || Original reverse primer was missing extra nucleotides at end, so amplification worked, cloning didn't |
|- | |- | ||
| Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill | | Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill | ||
|- | |- | ||
|} | |} | ||
Revision as of 21:08, 9 September 2011
EVERYONE PLEASE ENTER AND FILL OUT THE TABLE
For info on [http://en.wikipedia.org/wiki/Help:Table#Sorting Wiki Tables]
EXAMPLE TABLE (DO NOT MODIFY)
| Alphabetic | Numeric | Date | Unsortable |
|---|---|---|---|
| d | 20 | 2008-11-24 | This |
| b | 8 | 2004-03-01 | column |
| a | 6 | 1979-07-23 | cannot |
| c | 4.2 | 1492-12-08 | be |
| e | 0 | 1601-08-13 | sorted. |
TABLE TO BE FILLED OUT
LEGEND:
- Amplification Success (S, M, N): Was the amplification successful.
- S = Single Band at Desired Size
- M = Multiple Bands, but one at desired length
- N = No band at desired length
- Template Part #: The Registry Number of the Part being amplified from
- Template Form: The source form of the template DNA
- Miniprep (M)
- Colony (C)
- PCR Product (P)
- Template Source: Where the template is originally from, such as 2011 Parts Kits, Synthesized Gene, Genomic, etc
- Forward Primer (5'->3'): Full sequence of the Forward primer used
- Reverse Primer (5'->3'): Full sequence of the Reverse primer used
- Annealing Temperature (Celsius): The annealing temperature used in the PCR reaction
- Extension Time (seconds): The extension time used in the PCR reaction
- Percent DMSO: Was DMSO added, if not 0, if so at what %
- Polymerase Used: Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc)
- Primer Name: The name of the primer ordered
- Additional Notes: Any additional relevant information
| Amplification Success (S, M, N) | Template Part # | Template Form (M, C, P) | Template Source | Forward Primer (5'->3') | Reverse Primer (5'->3') | Annealing Temperature (Celsius) | Extension Time (seconds) | Percent DMSO | Polymerase Used | Forward Primer Name | Reverse Primer Name | Additional Notes |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| S | TBD | M | Synthesized Gene | GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA | CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG | 60 | 30 | 0 | Phusion | EX_Decarb_F | RedDecarb_SP_2 | Original reverse primer was missing extra nucleotides at end, so amplification worked, cloning didn't |
| Fill | Fill | Fill | Fill | Fill | Fill | Fill | Fill | Fill | Fill | Fill | Fill | Fill |
