"
Team:NTNU Trondheim/Data
From 2011.igem.org
(→Data) |
(→Data) |
||
| Line 39: | Line 39: | ||
| - | |||
| - | |||
| - | |||
| Line 56: | Line 53: | ||
| + | |||
| + | The new rrnB P1 biobrick was inserted in the psb1C3 plasmid provided by the iGem HQ. | ||
| + | Plasmid from five colonies were digested with the enzymes ....... and .............. giving the lengths ........... and ................ if the promoter was inserted. | ||
| + | |||
| + | |||
| + | It seems like parallel 1 and 2 have the insert. | ||
Revision as of 12:32, 23 August 2011
Data
rrnB P1 promoter
The rrnB P1 promoter is negatively regulated by ppGpp [Kilde] and therefore sutible for our stress sensor. We found the promoter in the registry distribution (BBa_K112118) submitted by Berkly in 2008.
This part is in the BBb standard form [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard] and is not compatible with the parts in the BBa standard. In order to get the part in BBa standard we PCR amplified the promoter using the BBa_K112118 as template and primers containing the BBa prefix and suffix:
| Primer | Type | Sequence |
|---|---|---|
| rrnB P1 F | Forward | GTTTCTTCGAATTCGCGGCCGCTTCTAGAGACGTATCCTACGCCCGTGGT |
| rrnB P1 R | Reverse | GTTTCTTCCTGCAGCGGCCGCTACTAGTACGCCTTCCCGCTACAGAGTCA |
The PCR-product was run on a 1,5% agarose gel in order to verify that we had achieved the correct product and to separate it from any other unwanted products.
The new rrnB P1 biobrick was inserted in the psb1C3 plasmid provided by the iGem HQ.
Plasmid from five colonies were digested with the enzymes ....... and .............. giving the lengths ........... and ................ if the promoter was inserted.
It seems like parallel 1 and 2 have the insert.
Stress Sensor
