Team:NTNU Trondheim/Data

From 2011.igem.org

(Difference between revisions)
(rrnB P1 promoter)
(rrnB P1 promoter)
Line 15: Line 15:
PCR amplified the promoter using the BBa_K112118 as template and primers containing the BBa prefix and suffix:
PCR amplified the promoter using the BBa_K112118 as template and primers containing the BBa prefix and suffix:
-
[[File: Test_rrnB_C3_060811_wiki.jpg|thumb|PCR products from rrnB P1 BioBrick separated on 1.5 % agarose. The marked products represent rrnB P1 with regular pre/sufix]]
+
[[File: Test_rrnB_C3_060811_wiki.jpg|thumb|rrnB P1 promoter in the psb1C3 plasmid]]

Revision as of 12:28, 23 August 2011



Data

rrnB P1 promoter

PCR products from rrnB P1 BioBrick separated on 1.5 % agarose. The marked products represent rrnB P1 with regular pre/sufix

The rrnB P1 promoter is negatively regulated by ppGpp [Kilde]. We found the promoter in the registry distribution (BBa_K112118) submitted by Berkly in 2008.

This part is in the BBb standard form [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard] and is not compatible with the parts in the BBa standard. In order to get the part in BBa standard we PCR amplified the promoter using the BBa_K112118 as template and primers containing the BBa prefix and suffix:

rrnB P1 promoter in the psb1C3 plasmid


Primer Type Sequence
rrnB P1 F Forward GTTTCTTCGAATTCGCGGCCGCTTCTAGAGACGTATCCTACGCCCGTGGT
rrnB P1 R Reverse GTTTCTTCCTGCAGCGGCCGCTACTAGTACGCCTTCCCGCTACAGAGTCA

The PCR-product was run on a 1,5% agarose gel in order to verify that we had achieved the correct product and to separate it from any other unwanted products.


The new rrnB P1 biobrick was inserted in the psb1C3 plasmid provided by the iGem HQ. Plasmid from five colonies were digested with the enzymes ....... and .............. giving the lengths ........... and ................ if the promoter was inserted.


It seems like parallel 1 and 2 have the insert.

Stress Sensor