"
Team:EPF-Lausanne/Notebook/May2011
From 2011.igem.org
(→Wednesday, 11 May 2011) |
|||
| Line 1: | Line 1: | ||
| + | {{:Team:EPF-Lausanne/Templates/headerMinimalNew}} | ||
| + | |||
Note: this is not week 1. We are just writing here to have it somewhere | Note: this is not week 1. We are just writing here to have it somewhere | ||
| Line 44: | Line 46: | ||
The primers were designed using the online tool [http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi| Primer3Plus] | The primers were designed using the online tool [http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi| Primer3Plus] | ||
| + | |||
| + | == Monday, 16 May 2011 == | ||
| + | |||
| + | Alina and Douglas prepared solutions of LacI and primers for sequencing, ready to send out to microsynth. | ||
Revision as of 16:03, 16 May 2011
{{{title}}}
Note: this is not week 1. We are just writing here to have it somewhere
Wednesday, 11 May 2011
SU8 Training for Lilia, Vincent, and Douglas. We made one complete flow wafer.
Work done, initially on four blank wafers:
- O2 plasma stripped
- SU8 spin-coated + baked. Most wafers had defects (bubbles, or even comets).
- UV exposure of flow pattern
- The best wafer was post-expose baked. The others were left unpolymerised
- Developed in PGMEA. The three non-baked wafers are now stripped and blank again.
- Valid wafer verified by optical microscopy and contact profilometry. Some dust contamination, will need to be blow-cleaned before PDMS moulding.
- The three other wafers can be cleaned and re-used (SRD, Pirana solution, 02 plasma strip).
For details of the process, see protocol for SU8 processes: [http://cmi.epfl.ch/photo/photo_process/files/Sawatec_processSU8.php| SU8 Process by CMI]
Friday, 13 May 2011
Alina and Douglas designed primers for the sequence verification of the lysis cassette. Four 'forwards' and three 'backwards' primers are needed to sequence the DNA in four segments:
>_1289_F |X|13.05.2011 ttgtcggtgaacgctctcta >_1734_R |X|13.05.2011 cctggctctagtaatttcattcag >_947_F |X|13.05.2011 gcggaatcctgagaaatgct >_440_F |X|13.05.2011 tcctgttgataaaactatggatgaa >_1333_R |X|13.05.2011 cgaaggtgagccagtgtgac >_30_F |X|13.05.2011 agggtctatggcagcaccta >_816_R |X|13.05.2011 caaatgaccgatgccaatag
The primers were designed using the online tool [http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi| Primer3Plus]
Monday, 16 May 2011
Alina and Douglas prepared solutions of LacI and primers for sequencing, ready to send out to microsynth.
