Team:HokkaidoU Japan/Protocols/Primers
From 2011.igem.org
(Difference between revisions)
m (Created page with "{{Team:HokkaidoU_Japan/header}} =Primers= ==Note== {|class="primer" style="text-align:center;" |- !rowspan="2"|Primer Name |colspan="4" style="text-align:left;"|Whole Sequence |-...") |
|||
Line 1: | Line 1: | ||
{{Team:HokkaidoU_Japan/header}} | {{Team:HokkaidoU_Japan/header}} | ||
+ | {{Team:HokkaidoU_Japan/Protocols/LeftContent}} | ||
+ | |||
+ | <div id="hokkaidou-right-content"> | ||
=Primers= | =Primers= | ||
==Note== | ==Note== | ||
Line 88: | Line 91: | ||
|style="width:61px;"|Forward||style="width:306px; text-align:left;"|SlrP coding sequence, from 373bp to 394 bp||style="width:51px;"|63.4 C||style="width:306px; text-align:left;"|None | |style="width:61px;"|Forward||style="width:306px; text-align:left;"|SlrP coding sequence, from 373bp to 394 bp||style="width:51px;"|63.4 C||style="width:306px; text-align:left;"|None | ||
|} | |} | ||
+ | </div> | ||
{{Team:HokkaidoU_Japan/footer}} | {{Team:HokkaidoU_Japan/footer}} |
Revision as of 06:50, 5 October 2011
HokkaidoU Japan
iGEM 2011 Team of Hokkaido University
Contents |
Primers
Note
Primer Name | Whole Sequence | |||
---|---|---|---|---|
F/R | Annealing Sequence | Tm | Adding Sequence |
General Primers
EX_F | gcagaattcgcggccgcttctagag | |||
---|---|---|---|---|
Forward | Biobrick Prefix | 74.5 C | None | |
PS_R | agcctgcagcggccgctactagta | |||
Reverse | Biobrick Suffix | 74.6 C | None | |
suffix_F | tactagtagcggccgctgcaggct | |||
Forward | Biobrick Suffix | 74.6 C | None | |
prefix_R | ctctagaagcggccgcgaattctgc | |||
Reverse | Biobrick Prefix | 74.5 C | None | |
100up_EX_F | aacctataaaaataccgcatacac | |||
Forward | 100bp upstream from Biobrick prefix | 62.7 C | None | |
200dn_PS_R | tcccctgattctgtggataaccgt | |||
Reverse | 200bp downstream from Biobrick suffix | 66.6 C | None |
- [http://partsregistry.org/wiki/index.php?title=Part:BBa_K496000 See details of 100up_EX_F/200dn_PS_R] (partsregistry)
Primers Used for Backbone Construction
EX_RBS_SlrP_F | GCAGAATTCGCGGCCGCTTCTAGAaaagaggagaaaatatgtttaatattactaatatacaatctacggc | |||
---|---|---|---|---|
Forward | RBS sequence, 5' terminal of SlrP coding sequence | 69.7 C | Biobrick Prefix | |
PS_SlrP_R | AGCCTGCAGCGGCCGCTACTAGTggtaagtcctaatattttcagacgaag | |||
Reverse | 3'terminal of SlrP coding sequence | 64.5 C | Biofusion Suffix | |
Bsa1_dt_F | GGCGACTAGAGAGACCccaggcatcaaataaaacgaaag | |||
Forward | 5'terminal of double terminator sequence | 63.6 C | BsaI recognition site and its cleavage site | |
Bsa1_SlrP_R | GGCCTGGCCTGAGACCCCggtaagtcctaatattttcagacga | |||
Reverse | 3'terminal of SlrP coding Sequence | 63.0 C | BsaI recognition site and its cleavage site | |
Bsa1_GSK_SlrP_R | GGCCTGGCCTGAGACCCCACTTTCAGCGAAACTTGTAGTGCGAGGGCGACCACTCATggtaagtcctaatattttcagacga | |||
Reverse | 3'terminal of SlrP coding Sequence | 63.6 C | GSK Tag, BsaI recognition site and its cleavage site |
- See details of BsaI Backbone (Project Page)
Sequencing Primer
SlrP_373_to_394_F | gaaagtcagtcacctatacccg | |||
---|---|---|---|---|
Forward | SlrP coding sequence, from 373bp to 394 bp | 63.4 C | None |