|
|
| Line 4: |
Line 4: |
| | [[Team:HokkaidoU Japan/Protocols/Primers|Primers]] | | [[Team:HokkaidoU Japan/Protocols/Primers|Primers]] |
| | | | |
| - | =Primers=
| |
| - | ===Note===
| |
| - | {|class="primer" style="text-align:center;"
| |
| - | |-
| |
| - | !rowspan="2"|Primer Name
| |
| - | |colspan="4" style="text-align:left;"|Whole Sequence
| |
| - | |-
| |
| - | |style="width:61px;"|F/R||style="width:306px; text-align:left;"|Annealing Sequence||style="width:51px;"|Tm||style="width:306px; text-align:left;"|Adding Sequence
| |
| - | |}
| |
| - |
| |
| - |
| |
| - | ===General Primers===
| |
| - | {|class="primer" style="text-align:center;"
| |
| - | |-
| |
| - | !rowspan="2"|EX_F
| |
| - | |colspan="4" style="text-align:left;"|gcagaattcgcggccgcttctagag
| |
| - | |-
| |
| - | |style="width:61px;"|Forward||style="width:306px; text-align:left"|Biobrick Prefix||style="width:51px;"|74.5 C||style="width:306px; text-align:left;"|None
| |
| - | |-
| |
| - | !rowspan="2"|PS_R
| |
| - | |colspan="4" style="text-align:left;"|agcctgcagcggccgctactagta
| |
| - | |-
| |
| - | |Reverse||style="text-align:left;"|Biobrick Suffix||74.6 C||style="text-align:left;"|None
| |
| - | |-
| |
| - | !rowspan="2"|suffix_F
| |
| - | |colspan="4" style="text-align:left;"|tactagtagcggccgctgcaggct
| |
| - | |-
| |
| - | |Forward||style="text-align:left;"|Biobrick Suffix||74.6 C||style="text-align:left;"|None
| |
| - | |-
| |
| - | !rowspan="2"|prefix_R
| |
| - | |colspan="4" style="text-align:left;"|ctctagaagcggccgcgaattctgc
| |
| - | |-
| |
| - | |Reverse||style="text-align:left;"|Biobrick Prefix||74.5 C||style="text-align:left;"|None
| |
| - | |-
| |
| - | !rowspan="2"|100up_EX_F
| |
| - | |colspan="4" style="text-align:left;"|aacctataaaaataccgcatacac
| |
| - | |-
| |
| - | |Forward||style="text-align:left;"|100bp upstream from Biobrick prefix||62.7 C||style="text-align:left;"|None
| |
| - | |-
| |
| - | !rowspan="2"|200dn_PS_R
| |
| - | |colspan="4" style="text-align:left;"|tcccctgattctgtggataaccgt
| |
| - | |-
| |
| - | |Reverse||style="text-align:left;"|200bp downstream from Biobrick suffix||66.6 C||style="text-align:left;"|None
| |
| - | |}
| |
| - |
| |
| - | *[http://partsregistry.org/wiki/index.php?title=Part:BBa_K496000 See details of 100up_EX_F/200dn_PS_R] (partsregistry)
| |
| - |
| |
| - |
| |
| - | ===Primers Used for Backbone Construction===
| |
| - | {|class="primer" style="text-align:center;"
| |
| - | |-
| |
| - | !rowspan="2"|EX_RBS_SlrP_F
| |
| - | |colspan="4" style="text-align:left;"|GCAGAATTCGCGGCCGCTTCTAGAaaagaggagaaaatatgtttaatattactaatatacaatctacggc
| |
| - | |-
| |
| - | |style="width:61px;"|Forward||style="width:306px; text-align:left"|RBS sequence, 5' terminal of SlrP coding sequence||style="width:51px"|69.7 C||style="width:306px; text-align:left;"|Biobrick Prefix
| |
| - | |-
| |
| - | !rowspan="2"|PS_SlrP_R
| |
| - | |colspan="4" style="text-align:left;"|AGCCTGCAGCGGCCGCTACTAGTggtaagtcctaatattttcagacgaag
| |
| - | |-
| |
| - | |Reverse||style="text-align:left;"|3'terminal of SlrP coding sequence||64.5 C||style="text-align:left;"|Biofusion Suffix
| |
| - | |-
| |
| - | !rowspan="2"|Bsa1_dt_F
| |
| - | |colspan="4" style="text-align:left;"|GGCGACTAGAGAGACCccaggcatcaaataaaacgaaag
| |
| - | |-
| |
| - | |Forward||style="text-align:left;"|5'terminal of double terminator sequence||63.6 C||style="text-align:left;"|BsaI recognition site and its cleavage site
| |
| - | |-
| |
| - | !rowspan="2"|Bsa1_SlrP_R
| |
| - | |colspan="4" style="text-align:left;"|GGCCTGGCCTGAGACCCCggtaagtcctaatattttcagacga
| |
| - | |-
| |
| - | |Reverse||style="text-align:left;"|3'terminal of SlrP coding Sequence||63.0 C||style="text-align:left;"|BsaI recognition site and its cleavage site
| |
| - | |-
| |
| - | !rowspan="2"|Bsa1_GSK_SlrP_R
| |
| - | |colspan="4" style="text-align:left;"|GGCCTGGCCTGAGACCCCACTTTCAGCGAAACTTGTAGTGCGAGGGCGACCACTCATggtaagtcctaatattttcagacga
| |
| - | |-
| |
| - | |Reverse||style="text-align:left;"|3'terminal of SlrP coding Sequence||63.6 C||style="text-align:left;"|GSK Tag, BsaI recognition site and its cleavage site
| |
| - | |}
| |
| - |
| |
| - | *[https://2011.igem.org/Team:HokkaidoU_Japan/Project/Backbone See details of BsaI Backbone] (Project Page)
| |
| - |
| |
| - |
| |
| - | ===Sequencing Primer===
| |
| - | {|class="primer" style="text-align:center;"
| |
| - | |-
| |
| - | !rowspan="2"|SlrP_373_to_394_F
| |
| - | |colspan="4" style="text-align:left;"|gaaagtcagtcacctatacccg
| |
| - | |-
| |
| - | |style="width:61px;"|Forward||style="width:306px; text-align:left;"|SlrP coding sequence, from 373bp to 394 bp||style="width:51px;"|63.4 C||style="width:306px; text-align:left;"|None
| |
| - | |}
| |
| | | | |
| | {{Team:HokkaidoU_Japan/footer}} | | {{Team:HokkaidoU_Japan/footer}} |
"
