Wild-type

caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.99353, 0.78661, 0.61233, 0.48347, 0.40302, 0.31833, 0.17311 0.0031579, 0.0052541, 0.0059555, 0.0069092, 0.0041919, 0.0052347, 0.0024241 4 0, 1, 2.5, 5 0.00000, 0.0014, 0.0028, 0.0042, 0.0056, .0070, .0140 0.99353, 1.02920, 1.05770, 1.12136, 0.78661, 1.00142, 1.02352, 1.06377, 0.61233, 0.90829, 0.95385, 1.06676, 0.48347, 0.77363, 0.85365, 0.99591, 0.40302, 0.67853, 0.74660, 0.93119, 0.31833, 0.56058, 0.62386, 0.83851, 0.17311, 0.33178, 0.40330, 0.58631 0.0031579, 0.0078785, 0.0087252, 0.0491108, 0.0052541, 0.0065114, 0.0028587, 0.0289843, 0.0059555, 0.0047101, 0.0029583, 0.0241440, 0.0069092, 0.0036622, 0.0052977, 0.0270465, 0.0041919, 0.0042828, 0.0210219, 0.0054843, 0.0052347, 0.0067734, 0.0282990, 0.0027105, 0.0024241, 0.0038951, 0.0043371, 0.0029370

Mutant 1

caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.84293, 0.52501, 0.28185, 0.14559, 0.082367, 0.05077, 0.017707 .017132, .016563, .010138, .0083723, .0036696, .0013295, .00029933 0, 1, 2.5, 5 0.00000, 0.0014, 0.0028, 0.0042, 0.0056, .0070, .0140 0.84293, 0.87306, 0.88569, 0.88705, 0.52501, 0.73231, 0.85955, 0.86384, 0.28185, 0.49594, 0.754, 0.85027, 0.14559, 0.30866, 0.53435, 0.79143, 0.082367, 0.20109, 0.38603, 0.6632, 0.05077, 0.13482, 0.28296, 0.59708, 0.017707, 0.062278, 0.080463, 0.22066 0.017132, 0.017727, 0.020661, 0.014524, 0.016563, 0.0095391, 0.013332, 0.024361, 0.010138, 0.017069, 0.017257, 0.019877, 0.0083723, 0.0064858, 0.006745, 0.035387, 0.0036696, 0.0024604, 0.014455, 0.017886, 0.0013295, 0.0017976, 0.0039159, 0.011506, 0.00029933, 0.0014914, 0.00096534, 0.0054255

Mutant 2

caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattattgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacgca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.66043, 0.44899, 0.27847, 0.19007, 0.14271, 0.11669, 0.061421 .018716, .015384, .0098251, .011268, .0061044, .0030215, .0008294 0, 1, 2.5, 5 0.00000, 0.0014, 0.0028, 0.0042, 0.0056, .0070, .0140 0.66043, 0.72139, 0.72156, 0.68292, 0.44899, 0.6366, 0.71926, 0.69494, 0.27847, 0.45878, 0.63883, 0.68131, 0.19007, 0.33367, 0.48602, 0.61718, 0.14271, 0.2557, 0.3774, 0.53217, 0.11669, 0.19954, 0.29437, 0.4718, 0.061421, 0.096767, 0.1356, 0.25018 0.018716, 0.012137, 0.012946, 0.017598, 0.015384, 0.012073, 0.011769, 0.010884, 0.0098251, 0.014087, 0.005962, 0.016007, 0.011268, 0.010077, 0.0063601, 0.032621, 0.0061044, 0.010882, 0.0061672, 0.029959, 0.0030215, 0.0073785, 0.00397, 0.01491, 0.0008294, 0.0070557, 0.0015888, 0.0026091

Mutant 3

caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaaagtgagttagctcactcattaggcaccccaggctttacactttaagcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.63328, 0.35345, 0.1976, 0.1104, 0.065516, 0.042821, 0.014963 .033565, .014178, .0098194, .011065, .0057402, .0026293, .00076312 0, 1, 2.5, 5 0.00000, 0.0014, 0.0028, 0.0042, 0.0056, .0070, .0140 0.63328, 0.69271, 0.71026, 0.75696, 0.35345, 0.51328, 0.67568, 0.7587, 0.1976, 0.3267, 0.50067, 0.70773, 0.1104, 0.20677, 0.33992, 0.52743, 0.065516, 0.13261, 0.23971, 0.41148, 0.042821, 0.085832, 0.16709, 0.35498, 0.014963, 0.022957, 0.035527, 0.12963 0.033565, 0.036371, 0.039807, 0.021793, 0.014178, 0.0060065, 0.023267, 0.019054, 0.0098194, 0.0058528, 0.0066284, 0.015857, 0.011065, 0.0034758, 0.0039971, 0.064364, 0.0057402, 0.0017609, 0.0055395, 0.040444, 0.0026293, 0.0013106, 0.0046305, 0.012042, 0.00076312, 0.00032783, 0.00066923, 0.0016036

Mutant 4

caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgcgcgcaacgcaactaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacgca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.31767, 0.17005, 0.10219, 0.063898, 0.045055, 0.034767, 0.017343 .010988, .0044378, .0031212, .004087, .0025152, .00043641, .00020276 0, 1, 2.5, 5 0.00000, 0.0014, 0.0028, 0.0042, 0.0056, .0070, .0140 0.31767, 0.34757, 0.3608, 0.34776, 0.17005, 0.25419, 0.33186, 0.33032, 0.10219, 0.17489, 0.26515, 0.31199, 0.063898, 0.1182, 0.19703, 0.26871, 0.045055, 0.082478, 0.14751, 0.21937, 0.034767, 0.060288, 0.10815, 0.18865, 0.017343, 0.023308, 0.030312, 0.080942 0.010988, 0.010027, 0.012595, 0.013208, 0.0044378, 0.0050367, 0.007641, 0.0075742, 0.0031212, 0.005471, 0.0023857, 0.0096344, 0.004087, 0.0019016, 0.006205, 0.020668, 0.0025152, 0.0020285, 0.0039214, 0.012822, 0.00043641, 0.00055117, 0.0010622, 0.003141, 0.00020276, 0.00023033, 0.0010985, 0.0010405

Mutant 5

caatacgcaaaccgcctctccccgcgcgtcggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctccctcatcaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.76419, 0.45666, 0.25652, 0.16829, 0.11854, 0.093686, 0.054054 .032442, .013252, .012617, .0085441, .005527, .0017459, .00062193 0, 1, 2.5, 5 0.00000, 0.0014, 0.0028, 0.0042, 0.0056, .0070, .0140 0.76419, 0.80169, 0.82451, 0.85141, 0.45666, 0.68378, 0.8154, 0.86986, 0.25652, 0.43459, 0.66544, 0.83262, 0.16829, 0.29358, 0.48126, 0.69943, 0.11854, 0.20404, 0.34253, 0.59125, 0.093686, 0.14943, 0.25307, 0.51915, 0.054054, 0.067506, 0.085897, 0.21106 0.032442, 0.043917, 0.042233, 0.0095133, 0.013252, 0.0084313, 0.023269, 0.01513, 0.012617, 0.0056627, 0.0086734, 0.017897, 0.0085441, 0.003882, 0.0078432, 0.052522, 0.005527, 0.0025057, 0.0039495, 0.039797, 0.0017459, 0.0017848, 0.0035247, 0.011518, 0.00062193, 0.0012843, 0.0010686, 0.002401

Mutant 6

caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctctacactttatgcttccggcttgtatgttgtgtggaattgtgagcggataacaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.55751, 0.39467, 0.26512, 0.17411, 0.12033, 0.086001, 0.036371 .0075946, .005595, .0042456, .00568, .0048842, .002313, .00049314 0, 1, 2.5, 5 0.00000, 0.0014, 0.0028, 0.0042, 0.0056, .0070, .0140 0.55751, 0.56255, 0.56785, 0.58454, 0.39467, 0.4926, 0.56662, 0.562, 0.26512, 0.37128, 0.50313, 0.57582, 0.17411, 0.27137, 0.39351, 0.53095, 0.12033, 0.20031, 0.30487, 0.46169, 0.086001, 0.14549, 0.23471, 0.39465, 0.036371, 0.058668, 0.095081, 0.21265 0.0075946, 0.017581, 0.014201, 0.005585, 0.005595, 0.0047018, 0.012246, 0.022603, 0.0042456, 0.0035865, 0.0081421, 0.0054892, 0.00568, 0.0027604, 0.0041534, 0.013642, 0.0048842, 0.0017498, 0.0031374, 0.016814, 0.002313, 0.0013403, 0.0029052, 0.003605, 0.00049314, 0.00084767, 0.00089771, 0.0015101

Mutant 7

caatacgcaaaccgcctctccccgcgcgttggccgattcattagtgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgtagtgtggaattgtgagcggatatcaatttcacaca 0, .0014, .0028, .0042, .0056, .0070, .0140 0.85845, 0.62076, 0.43628, 0.30625, 0.24044, 0.19269, 0.10768 .0.0224439, 0.0111706, 0.0095075, 0.0129382, 0.0093905, 0.0026913, 0.0024300 0, 1, 2.5, 5 0.00000, 0.0014, 0.0028, 0.0042, 0.0056, .0070, .0140 0.85845, 0.90713, 0.94177, 0.95054, 0.62076, 0.83675, 0.93042, 0.92862, 0.43628, 0.67716, 0.87094, 0.94269, 0.30625, 0.51206, 0.77736, 0.88470, 0.24044, 0.40324, 0.60534, 0.82591, 0.19269, 0.31550, 0.49199, 0.78601, 0.10768, 0.17867, 0.24798, 0.50439 0.0224439, 0.0223095, 0.0293059, 0.0159658, 0.0111706, 0.0105817, 0.0186839, 0.0148995, 0.0095075, 0.0107458, 0.0224771, 0.0174710, 0.0129382, 0.0081189, 0.0091454, 0.0513437, 0.0093905, 0.0053745, 0.0250836, 0.0373250, 0.0026913, 0.0038961, 0.0073887, 0.0121860, 0.0024300, 0.0021880, 0.0027920, 0.0059692

This widget displays the GFP fluorescence data we have collected for our seven LacI promoter mutants as well as the wild-type promoter using the constructs listed on the LacI project page. Repressor transcription is initiated by induction with arabinose, while IPTG binds and reduces repressor activity, thereby increasing promotion of GFP. You may select any combination of mutants to display simultaneously by toggling them on or off with the buttons on the right side. This allows you to easily view the strength of a mutant of interest in comparison to wildtype or other mutants.

Thanks to our new KO3D library, you may also view characterization data for all variants in resonse to IPTG and arabinose by selecting the '3D Plot' button. This will present you with a graph of the relative fluorescence for the promoter of interest plotted at varying IPTG and arabinose levels. You can click drag the 3D plot with your mouse to view the data from different angles.

Please note that error bars are displayed for both 2D and 3D data by single lines originating from sampled points, even though these lines are not easily visible at all sampling conditions. 3D data has been interpolated for colormapping, but the shape of the curve has not been smoothed and sampled points are clearly marked by intersecting lines. All of the mutant sequences and corresponding Parts Registry pages can be found here.

Modeling

The genetic construct used to characterize our parts is constructed as follows:



Essentially, constitutively-expressed AraC on the genome of our strain (BW22826) regulates the expression of the pBAD promoter. L-Arabinose can bind to AraC, derepressing pBAD and upregulating the amount of LacI repressor present. LacI then represses our mutant (or wildtype) promoter, with IPTG acting as an inducer. The entire construct can be modeled with the following set of equations:



For a more complete description of the parameters, click here.