"

From 2011.igem.org

Revision as of 22:06, 21 September 2011 (view source) HannahRalph (Talk | contribs) ← Older edit		Revision as of 23:15, 21 September 2011 (view source) HannahRalph (Talk | contribs) Newer edit →
Line 27:		Line 27:
	</table>		</table>
		+	The part is still awaiting synthesis.<br/><br/>
-	<h2>Results</h2>	+	You can visit the Multiple Cloning Site Part Page <a href=https://2011.igem.org/Team:Glasgow/mcs>here</a>

---

Revision as of 23:15, 21 September 2011

Aims

- To produce an easier method for testing large numbers of biobricks
- To reduce the overall number of ligations needed to do this

Method

The restriction enzymes we chose to include in our Multiple Cloning Site are XhoI, BamHI, SalI, BglI and HindIII.



We designed primers and had the Multiple Cloning Site biobrick synthesized. These primers are below:

Forward Primer	5'-aattcgcggccgcttctagagggtaccggcgccctcgagggatcca agcttTactagagaaaaaaaaaccccgcccctgacagggcggggttttt ttttactagtagcggccgctgca-3'
Reverse Primer	5'-GCGGCCGCTACTAGTAAAAAAAAACCCCGCCCTGTCAGGGGCGGGG TTTTTTTTTCTCTAGTAAAGCTTGGATCCCTCGAGGGCGCCGGTACCCTCTAGAAGCGGCCGCG-3'

The part is still awaiting synthesis.

You can visit the Multiple Cloning Site Part Page here