"
Team:Glasgow/Results/MCS
From 2011.igem.org
(Difference between revisions)
HannahRalph (Talk | contribs) (Created page with "{{Team:Glasgow/Header}} <html> <h2>Aims</h2> - To produce an easier method for testing large numbers of biobricks<br/> - To reduce the overall number of ligations needed to do th...") |
HannahRalph (Talk | contribs) |
||
| Line 10: | Line 10: | ||
<center><img src=https://static.igem.org/mediawiki/2011/0/00/Glasgowmcsonly.png></center> | <center><img src=https://static.igem.org/mediawiki/2011/0/00/Glasgowmcsonly.png></center> | ||
<br/><Br/> | <br/><Br/> | ||
| - | We designed primers and had the Multiple Cloning Site biobrick synthesized. These primers are below: | + | We designed primers and had the Multiple Cloning Site biobrick synthesized. These primers are below:<br/><Br/> |
<u>Forward Primer</u><br/><br/> | <u>Forward Primer</u><br/><br/> | ||
Revision as of 21:59, 21 September 2011
Aims
- To produce an easier method for testing large numbers of biobricks- To reduce the overall number of ligations needed to do this
Method
The restriction enzymes we chose to include in our Multiple Cloning Site are XhoI, BamHI, SalI, BglI and HindIII.
We designed primers and had the Multiple Cloning Site biobrick synthesized. These primers are below:
Forward Primer
5'-aattcgcggccgcttctagagggtaccggcgccctcgagggatcca agcttTactagagaaaaaaaaaccccgcccctgacagggcggggttttt ttttactagtagcggccgctgca-3'
Reverse Primer
5'-GCGGCCGCTACTAGTAAAAAAAAACCCCGCCCTGTCAGGGGCGGGG TTTTTTTTTCTCTAGTAAAGCTTGGATCCCTCGAGGGCGCCGGTACCCT CTAGAAGCGGCCGCG-3'
