Team:EPF-Lausanne/Our Project/T7 promoter variants/t7prom
From 2011.igem.org
(→Non-random T7 promoter variants) |
|||
Line 14: | Line 14: | ||
=== List and Sequences of Variants === | === List and Sequences of Variants === | ||
- | + | ===Non-random T7 promoter variants=== | |
Variants without additional lac operator (constitutive): | Variants without additional lac operator (constitutive): |
Revision as of 20:08, 21 September 2011
Lysis Selection System
Lysis selection system Main | Lysis Characterization | DNA Recovery | DNA Selection | T7 Promoter VariantsContents |
T7 Promoter Variants
Introduction
The success of any piece of biological circuitry, like the kind we are presenting in our system, hinges substantially on the time-scales required for the activation of its components. If one component reacts more quickly than another, the whole system will desynchronize and all pertinent biological information will be lost.
In our case, one of the key steps is the activation of the lysis cassette which is controlled by the T7 promoter. The rest of the system -- including any reporter systems that would lead to T7 RNA polymerase binding to a T7 promoter -- may depend on other parameters that affect the timescales in very delicate ways. It becomes crucial to have a variety of T7 promoter variants on hand, each of which has different strengths and efficiencies in order to accomodate the various system time-scales.
We made two families of T7 promoter variants. Each family has six designed mutants and three randomer mutants. The only difference between the two families is the addition of a lac operator sequence downstream of the T7 promoter. These promoter variants were characterized using fluorescence, revealing a wide range of promoter efficiencies.
List and Sequences of Variants
Non-random T7 promoter variants
Variants without additional lac operator (constitutive):
Parts Registry Number | Strength | Mutation Position | Sequence |
[http://partsregistry.org/Part:BBa_K613001 K613001] | Wildtype | None | TAATACGACTCACTATAGGGAGA |
[http://partsregistry.org/Part:BBa_K613002 K613002] | .14 | -16 | TGATACGACTCACTATAGGGAGA |
[http://partsregistry.org/Part:BBa_K613003 K613003] | .3 | -2 | TAATACGACTCACTACAGGGAGA |
[http://partsregistry.org/Part:BBa_K613004 K613004] | .54 | -17 | CAATACGACTCACTATAGGGAGA |
[http://partsregistry.org/Part:BBa_K613005 K613005] | .8 | 3 | TAATACGACTCACTATAGGGTGA |
[http://partsregistry.org/Part:BBa_K613006 K613006] | 1.11 | 3 | TAATACGACTCACTATAGGGCGA |
Variants with additional lac operator (LacI repressed):
[http://partsregistry.org/Part:BBa_K613007 K613007]
[http://partsregistry.org/Part:BBa_K613008 K613008]
[http://partsregistry.org/Part:BBa_K613009 K613009]
[http://partsregistry.org/Part:BBa_K613010 K613010]
[http://partsregistry.org/Part:BBa_K613011 K613011]
[http://partsregistry.org/Part:BBa_K613012 K613012]
Characterization of Designed Variants
Characterization of Randomer Variants