From 2011.igem.org

(Difference between revisions)

Revision as of 14:43, 18 September 2011

Introduction
Our Project
Tools
- Gibson Assembly
- MITOMI
Notebook
- Protocols
- May
- June
- July
- August
- September
- October
Considerations
- Human Practices
- Safety
Acknowledgements
- Sponsors
- Partners

Data

That's how the Data page should look like: https://igem.org/Sample_Data_Page
Perhaps we could only provide the link to the Registry page; if we put all the graphs here it's gonna be messy pages (TetR mutants, reporter plasmids and T7 variants)
We can make a "results" page with all the graphs, or put them in the descript

New parts

Medium-strength Plac

blablabla

TetR Mutants

Lilia, are you also putting the WT into biobrick?

V36F

Sequence

ATGTCCAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTTTCGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCT

P39K

Y42F

P39Q-Y42M

Sequence

ATGTCCAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTGTAGAGCAGCAAACAGTGATGTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCT

T7 Promoter Variants

Characterization of Variants Using Fluorescence

For each family, we tested the randomers and the designed variants separately. To characterize the promoter strengths, we used RFP as the reporter gene and used a platereader to test for fluorescence during and after induction with IPTG.

The six designed T7 promoter variants are named as a function of their predicted promoter efficiency, relative to the wildtype. For example, T7 14 has a predicted efficiency of 14% compared to the consensus T7 promoter, whereas T7 111 is predicted to be 111% more efficient than the wildtype. In the chart above, you find each of the designed promoter variants for both the T7 with and without the lac operator, arranged in increasing predicted efficiency. Contrary to our expectation, some variants that were designed to have a lesser efficiency than the wildtype (e.g. T7 54) seem to have a much higher strength (as measured by fluorescence at saturation, normalized by the optical density). Already in the designed variants, we see a substantial difference in the behavior of the promoters that have a lac operator as opposed to those that do not. The data for this graph was produced in triplicate, so the error bar represents the standard error across those three measurements.

In addition to fluorescence at saturation, another way to characterize promoter strength is to look at its induction ratio, which is the ratio, at saturation, of fluorescence produced by induction with IPTG versus fluorescence produced without induction. In layman's terms, it indicates how strongly the promoter reacts to induction. Here again, our results indicate that some promoter variants (T7 80 in particular) stand out with respect to this feature. Here too the importance of the lac operator in producing high induction ratios is not to be underestimated.

For the three sets of randomers for T7 with and without the lac operator, we tested seventy-two different variants and characterized their expression using the same IPTG induction protocol as with the designed variants. The goal of using these variants was to examine the range of expressions that can be produced by random mutations as opposed to directed mutations. The results, as presented in the graph, indicate that the designed variants (with and without lac operator put together) produce a much higher average normalized fluorescence than the randomers.

Characterization with Lysis

Since a major component of our scheme for selecting promoters and transcription factors with strong binding affinities required the ability to lyse cells, we also wanted to test a T7-driven lysis cassette.

Induction with various concentrations of IPTG reveals a stready increase in the amount of lysis that can be obtained. Here 500 uM yields the most substantial amount of lysis, and that concentration was used in all further experiments dealing with lysis. The negative controls were two-fold: one is an unsuccessful attempt at inserting the lysis cassette downstream of a T7 promoter in the psB3K1 plasmid, while the other is a T7 promoter upstream of an RFP gene. Neither should express lysis.

Other assemblies - without new biobrick

J61002 Ptet-RFP

Readout system - TetR and RFP

The first readout system is composed of TetR with a constitutive promoter, followed by RFP with a pTet promoter. If TetR binds to pTet, then RFP is repressed. This readout system is convenient for fluorescence detection experiments, but it would not be suited for using the lysis cassette as the reporter gene is being repressed upon TetR-pTet interaction. With the lysis device, the interesting cells (where TetR binds to pTet) would survive and we would recover only the useless TetR mutants.

The plasmids used here are pSB3K1 pConst-TetR and J61002 Ptet-RFP. For more details about them, please go to the "Reporter plasmids" tab

ATC induction

Dose-response

J61002 only

Readout system - TetR, LacI and RFP

This second readout system is composed of 3 genes: TetR under pConst control, LacI under pTet control (playing the role of an inverter) and finally RFP under pLac control. Here, RFP is induced when TetR binds to pTet. Lysis cassette can be put instead of RFP in thy system, having as a consequence that the cells where TetR mutants bind to pTet would lyse.

To get this readout system, we cotransformed pSB3K1 Pconst-TetR Ptet-LacI with J61002 Plac-RFP. Unfortunately, the sequence of Ptet in front of LacI got mutated during the assembly process, resulting in only a partial repression of LacI by TetR. Still, our results do show the effects of TetR and LacI on the whole system. For more details about the plasmids, please refer to the "Reporter plasmids" tab in the "Our project" menu.