Team:Harvard/Notebook

June 6th

First day of iGEM!

June 7th

Miniprep of pKD42 (lambda red)

The lambda red plasmid is needed to enable the recombination used to insert the selection/expression systems into our E. coli cultures.

Procedure: followed Qiagen Kit instructions, each student (8) using 1 mL cell suspension

Results: DNA reasonably pure (260/280 between 1.8 and 2) and between 25 and 50 ng/µL

June 8th

PCR to connect ultramers into OZ052 (Zif268 F2 triplicate, GCCGATGTC)and OZ123 (Zif268 F2 triplicate, GAGTGGTTA):

OZ052:

• 3µL OZ052_F (10µM stock)
• 3µL OZ052_R (10µM stock)
• 5µL 10x Pfx amplification buffer
• 1.5µL dNTPs
• 1µL MgSO4
• 0.4µL DNA polymerase
• 36.1µL ddH2O

OZ123:

• 3µL OZ123_F (10µM stock)
• 3µL OZ123_R (10µM stock)
• 5µL 10x Pfx amplification buffer
• 1.5µL dNTPs
• 1µL MgSO4
• 0.4µL DNA polymerase
• 36.1µL ddH2O

Parameters:

• 1) 94⁰C for 5 min
• 2) 94⁰C for 15 sec
• 3) 60⁰C for 30 sec
• 4) 68⁰C for 1 min
• 5) Repeat 2-4 for 25 cycles
• 6) 68⁰C for 5 min
• 7) 4⁰C forever

June 9th - Wet Lab

• Created cell culture with selection construct (contains ZFB, His3, pyrF on plasmid) and reporter RFP (this will be used to test positive control ZFs, cells fluoresce green when ZF binds)
  • Picked colonies, grew in LB/amp liquid media until mid-log
    • 3 mL of LB, 1.5 µL of 2000x amp
  • Once mid-log reached, created glycerol stock, stored stock at -80⁰C.
    • 300 µL bacteria, 1200 µL 80% glycerol This should have been 1200 µL bacteria media, 300 µL 80% glycerol (Corrected 6/14/2011) (80% pure glycerol, 20% molecular grade water)
  • Spiked new tubes of media with 25 µL bacteria from the mid-log tube to leave overnight

NOTE: reporter RFP did not grow to mid-log by end of day, will let grow overnight to saturation and continue creating glycerol stock tomorrow.

• Plated selection strain from gel stab onto tet plate.

• Began primer design for creating the kan/selection construct fusion.

June 9th - Bioinformatics

Today we focused on reacquainting and familiarizing ourselves with Python. We completed the parsing (reading in) of the sequence and amino acid data so that it is easy to work with: by substituting each amino acid abbreviation (ex. A, N) with its numeric equivalent (ex. 1, 14), we can use a lot of nice math comparisons instead of messy letter/"string" comparisons.

After that, we worked on counting the number of times each amino acid appears in each of the 7 positions (unfortunately given by -1,1,2,3,5,6,7), and counting the number of times amino acids are next to each other (ex. ACTQRNF has AC, CT, TQ, etc pairings). Taken overall, we found that L is overwhelmingly in position 5.

Acid	-1	1	2	3	5	6	7
A	77	140	210	197	0	312	85
C	12	24	1	6	14	0	0
D	413	16	694	258	0	142	14
E	125	74	152	107	0	58	132
F	0	0	22	0	10	0	0
G	12	201	328	125	0	177	62
H	93	144	232	652	0	51	17
I	70	21	3	26	0	94	73
K	108	372	46	169	6	321	52
L	176	37	20	22	3325	75	55
M	36	54	5	28	0	31	10
N	23	150	129	940	0	182	61
P	3	298	77	7	0	36	8
Q	813	158	180	13	0	136	30
R	870	539	137	55	3	428	2517
S	99	970	859	278	0	140	12
T	243	134	223	350	0	834	83
V	166	26	27	115	0	341	146
W	19	0	13	0	0	0	0
Y	0	0	0	10	0	0	1

For pairings, we found patterns, but none as obvious as the L-in-position-5. Read this like a multiplication table: the intersection of L row and M column is how often that pairing was observed.

'	A	C	D	E	F	G	H	I	K	L	M	N	P	Q	R	S	T	V	W	Y
A	10	0	99	55	0	29	122	20	32	332	2	59	55	63	255	87	24	43	0	0
C	0	0	15	0	0	3	0	0	0	5	0	0	6	0	31	6	14	0	0	0
D	99	15	94	92	0	39	62	6	84	342	15	120	55	42	277	290	87	21	0	8
E	55	0	92	42	0	34	77	1	38	141	2	39	4	29	134	28	90	26	0	1
F	0	0	0	0	0	0	0	10	0	0	0	22	4	0	2	4	6	0	0	0
G	29	3	39	34	0	38	56	0	14	126	1	95	28	47	119	125	38	7	0	0
H	122	0	62	77	0	56	118	9	103	498	4	88	24	26	87	159	70	2	0	0
I	20	0	6	1	10	0	9	6	8	95	3	5	17	3	62	16	17	4	0	0
K	32	0	84	38	0	14	103	8	84	386	24	44	19	102	269	163	113	22	1	0
L	332	5	342	141	0	126	498	95	386	174	32	686	16	112	362	276	875	360	0	8
M	2	0	15	2	0	1	4	3	24	32	0	7	2	11	39	14	3	1	0	0
N	59	0	120	39	22	95	88	5	44	686	7	8	36	28	120	254	84	34	1	0
P	55	6	55	4	4	28	24	17	19	16	2	36	0	3	29	150	21	13	11	0
Q	63	0	42	29	0	47	26	3	102	112	11	28	3	100	261	314	125	19	0	0
R	255	31	277	134	2	119	87	62	269	362	39	120	29	261	618	343	504	281	0	0
S	87	6	290	28	4	125	159	16	163	276	14	254	150	314	343	592	173	91	0	0
T	24	14	87	90	6	38	70	17	113	875	3	84	21	125	504	173	154	28	0	0
V	43	0	21	26	0	7	2	4	22	360	1	34	13	19	281	91	28	12	0	0
W	0	0	0	0	0	0	0	0	1	0	0	1	11	0	0	0	0	0	0	0
Y	0	0	8	1	0	0	0	0	0	8	0	0	0	0	0	0	0	0	0	0

Follow up work on this will be to convert this table to frequencies instead of values: values are less meaningful.

June 10th - Wet Lab

• What we learned today: don't put E. coli plates in the -20C freezer!

• Observed a well populated selection strain plate and placed it in the 4C refrigerator

• Took the selection construct culture and extracted the plasmid through miniprep
  • Observed 260/280 ratio of 1.90 and 1.88 through Nanodrop
  • Observed concentrations of 87.7 and 100.6 ng/µL through Nanodrop

• Made 10 new agar plates with LB and amp

June 10th - Bioinformatics

Visualizations

We spent the first few hours today making cool visualizations and graphs of the data we found on the 9th: heatmaps turned out to be an annoying limitation of Python, so a Python/R hybrid was used, and bar charts were made exclusively in Python. See the dropbox for our pretty (and hopefully informative compared to spreadsheets) charts/graphs.

A heatmap of the pairing data. The darker the blues indicate that the pairing occurs more often.

We then started work on TNN and GNN properties specifically (essentially repeating the June 9th work, but confined to smaller data sets). There are some differences between TNN and GNN: see graphs in dropbox. We decided that there was not enough data for fingers that bind to ANN and CNN triplets to perform significant analysis on it.

A heatmap of the GNN pairing data.

A heatmap of the TNN pairing data.

• Overall, similar color clusters are found in the heatmaps. In all cases, L and N are often placed consecutively on the helix. There are fewer clusters of high frequency when looking at TNN binders.

We then, using the theorized framework from a paper (2011 Persikov [http://iopscience.iop.org.ezp-prod1.hul.harvard.edu/1478-3975/8/3/035010/]), tried to match amino acid binding to each base pair to see if there was a pattern. See dropbox document .../bioinformatics/Binding Frequency for that data. There's a lot of it.

Properties of amino acids

We then worked on finding properties of the each position (hydrophobic/phillic, non/polar):

Hydrophilic vs Hydrophobic

Position	Very Phobic	Hydrophobic	Neutral	Hydrophillic
6	285	85	204	2782
5	542	312	1334	1169
4	3334	14	0	9
3	191	203	1417	1536
2	91	211	1819	1236
1	138	164	1604	1451
-1	468	90	1257	1542

Polar vs Nonpolar

Position	Polar	Nonpolar
6	2917	440
5	2290	1067
4	9	3348
3	2830	527
2	2652	705
1	2555	802
-1	2784	573

Follow up work here is to check more properties, and maybe try individual pairings (ex. phobic-philic, polar-phillic).

June 13th - Wet Lab

The control zinc fingers OZ052 and OZ123 were amplified with overhanging primers to allow its insertion into the Wolfe plasmid:

Overhang PCR for ultramers: the template was the product of the ultramer PCR (see 6/8/11), and several concentrations were used

In all the tubes:

• 5 µL Pfx amplification buffer
• 1.5 µL dNTPs
• 1 µL MgSO4
• 0.4 µL polymerase
• 38.1 µL ddH2O
• 1.5 µL OZ052_up and 1.5 µL OZ052_down OR 1.5 µL OZ123_up and 1.5 µL OZ123_down

In OZ052 (1) and OZ123 (1):

• 1 µL of ultramer PCR product

In OZ052 (1:10) and OZ123 (1:10):

• 1 µL of a 1 in 10 dilution of ultramer PCR product

In OZ052 (1:100) and OZ123 (1:100):

• 1 µL of a 1 in 100 dilution of ultramer PCR product

Parameters:

• 94⁰C for 5 min
• 94⁰C for 15 sec
• 55⁰C for 30 sec
• 68⁰C for 30 sec
• Repeat steps 2-4 for 25 cycles
• 68⁰C for 5 min
• 4⁰C forever

Gel to verify proper amplification (1% agarose gel, 10 µL 1 kb ladder, 120 V):

The OZ052 lanes (1-3) had bands at the proper length (328 bp) at all three concentrations, although there were several fainter bands likely from side products. Only the undiluted OZ123 lane showed any bands, and from the faint band at 328 and the stronger band around 250 it appears that the PCR did not work well, and the majority of the product was the ultramer from the first PCR.

PCR around vector: the template used was the Wolfe selection construct plasmid miniprepped 6/10/11 (100.6 ng/µL stock) Reagents the same as above except:

• 1.5 µL of Wolfe_F and 1.5 µL of Wolfe_R primers to each tube
• plasmid tube (1 ng) given 1 ng of template (1 µL of a 1 in 100 dilution)
• plasmid tube (10 ng) given 10 ng of template (1 µL of a 1 in 10 dilution)

Parameters same as above except:

• elongation (step 4) 5 minutes (vector approximately 5 kb)

Gel to verify proper amplification (1% agarose, 10 µL 1 kb ladder, 170V)

There were no bands of the correct size in the lanes. The only band that appeared was a faint, short band in one lane that likely was a primer. Since the DNA ladder worked, the problem likely was not with the electrophoresis but with the PCR reaction, perhaps due to issues with the primers.

Gel images

June 13th - Bioinformatics

Today we started work on a program to statistically generate possible sequences.

The four functions needed to do this are:

• generate(matrix, pseudocounts (lambda), dependency tuples)

takes a matrix of zinc-finger AA position counts, a list of dependent amino acid pairs, and a pseudocount multiplier and generates a list of potential amino acid sequences weighted by independent and dependent probabilities

• add_pseudo(dependent matrix row,independent matrix row)

given a matrix row of dependent counts (i.e. how many times 'a' occurs at position n when 'b' is set to some AA at position m) and a row of independent matrix counts (how many times 'a' occurs at n regardless of b's AA) return an adjusted matrix row, based on the dependent matrix row, that has pseudocounts added to the values that are empty in the dependent matrix row but filled in the independent matrix row.

• generate_indep(matrix)

randomly pick an amino acid, given a matrix row, from a weighted random distribution based on the values in the row

• generate_dep(indep_row, dep_row, lambda)

add pseudo counts (call add_pseudo) and generate a dependent random call for a position (using generate_indep on the adjusted matrix)

We finished generate_indep, generate_dep, and add_pseudo today, along with creating a 140x140 matrix of needed values.

June 14

Wet Lab

• Made four LB-based media solutions, and later created glycerol stocks from these and placed in -80⁰C freezer
  • Selection strain (ΔHis3ΔPyrFΔrpoZ) in 3 mL LB and 3µL of 1000x Tet solution stock
  • Selection strain (ΔHis3ΔPyrFΔrpoZ) in 3 mL of LB only solution stock (control)
  • Kan cassette (pZE22G) in 3 mL of LB solution stock and 3 µL of kanamycin solution stock
  • Lambda Red (pKD42) in 3 mL of LB and 3 µL Amp solution stock
    • For all of these stocks, we tried to grow all to mid-log and then place them in 1,200 µL of culture and 300 µL of 80 % glycerol solution (This is the correct protocol for creating a glycerol stock; refer to June 9th)
    • We were only able to get the kan cassette to mid-log and created glycerol stock of the kan cassette
    • Observations included contamination of a pKD46 liquid culture, and we are leaving Lambda Red and both solutions with the selection strain for overnight growth
• Ran 1% gel (150V) with the rest of the OZ123 and OZ052 overhang PCR samples
  • Used better ladder today, less the 1 kb ladder
  • Bands followed the same pattern as the gel run on 6/13/11
• Used gel extraction to obtain the correct OZ123 and OZ052 PCR product from the gel
  • Used Qiagen quick gel extraction kit
  • OZ052 (from undiluted lane): 7.0 ng/µL, 260/280=2.42 (Note: this sample had a strange yellow substance in the column, may have been contaminated)
  • OZ052 (from undiluted lane): 12.0 ng/µL, 260/280=2.02
  • OZ052 (from 1:10 dilution): 10.8 ng/µL, 260/280=2.04
  • OZ052 (from 1:10 dilution): 15.2 ng/µL, 260/280=1.82
  • OZ052 (from 1:100 dilution): 20.6 ng/µL, 260/280=2.17
  • OZ123 (from undiluted lane): 6.3 ng/µL, 260/280=2.17
• PCR the backbone fragment of the plasmid using Wolfe_R and Wolfe_L primers and a lower annealing temperature than before due to the lower melting point of Wolfe_L
  • Reagents:
    • 22µL Invitrogen Platinum PCR supermix
    • 1µL template from a 1 in 100 dilution (1 ng)
    • 1µL Wolfe_F and 1µL Wolfe_R
  • 94°C for 30 s
  • 94°C for 30 s
  • 53°C for 30 s
  • 70°C for 5 min
    • Previous three steps repeat 30 times
  • 70°C for 5 min
  • 4°C forever
• Performed a restriction enzyme digestion on the selection construct plasmid using EcoRI to test for presence/absence of inserted selection construct
  • 1µL EcoR1
  • 1µL buffer 4
  • 2µL backbone plasmid
  • 6µL ddH2O
  • Incubate at 37 degrees for 90 min
  • There is only one EcoR1 site (GAATTC) in the plasmid, so we should see 1 band at about 5kb
• Ran a gel (1%, 170 V) on the backbone fragment (Wolfe primers) PCR product and restriction digestion result
  • Observations: the EcoR1 digest produced the expected band of around 5kb. The backbone did produce a 5kb band but also had a secondary smaller product, perhaps due to one of the primers annealing to a sequence that is a close match to its target.
• Began gradient PCR on the selection strain backbone with Wolfe_R and Wolfe_F primers because of the large difference in melting temperatures between the two
  • Set the annealing temperatures within the PCR to go from 50-57 C and ran with 5 minute extension phases at 70 C
  • Ran overnight

Today's Gel Images

June 14 - Bioinformatics

We finished writing the generate function, and now have a working sequence generator. We also began more in-depth research into the 2011 work by Persikov which deals with how the zinc finger binds to DNA. He predicts several relations which we should be able to test.

Persikov sent us his SVM code (used to calculate the probability of a sequence binding to given DNA), so we also worked on adapting this to use when narrowing our sequences to those most likely to work.

• There are four canonical amino acid-base interactions involved in zinc finger interactions.
  • Amino acids in positions -1, 3, and 6 on the helix are known to interact with the 3 bases of the triplet. In addition, the amino acid in position 2 interacts with the upstream base of the complementary strand (Klug 2010).
  • In addition, Persikov (2011) has proposed novel interactions between these four amino acids based on his analysis of zinc finger binding data up to 2005.
  • Persikov uses the information between these four amino acid-base interactions in his SVM, to determine whether a finger would be a good binder to a particular DNA sequence.
• In order to use his program, we need to convert the helices that are created by the generator into a format the SVM accepts.
  • The SVM only considers the four canonical interactions. It assigns a numerical value to each possible amino acid-base combination. The program that converts our data into a format the SVM accepts creates a string with these numerical values based on Persikov's key. (See this page for more details on this program.)

Brandon learned basic Python today. Justin created a JavaScript program that recognizes potential binding sites from a given sequence.

June 15th - Wet Lab

Gradient PCR: 5µL of each PCR product were run on a 1% gel. No bands appeared: the PCR appears to not have worked.

Selection construct: bacteria containing the selection construct (plasmid containing ZF, omega subunit, ZFB, His3, URA3, etc.) was made into a glycerol stock (see 6/14 and 6/9), miniprepped, and used for PCR:

• Miniprep: used Qiagen kit
  • 82.5ng/µL, 260/280=1.99
  • 91.1ng/µL, 260/280=2.01
  • 77.9ng/µL, 260/280=1.98
• PCR:
  • PCR used to amplify section of plasmid containing zinc finger binding site, weak promoter, His3, and URA3 (with homology to join it to kan cassette)
  • Reagents
  • zinc finger binding site and weak promoter, selection construct plasmid:
    • 1µL ZFB-wp-f (5µM) (made by 1:20 dilution of 100µM stock)
    • 1µL ZFB-wp-hisura-r (5µM) (made by 1:20 dilution of 100µM stock)
    • 1µL selection construct (1:100 dilution of overnight culture)
    • 22.5µL of invitrogen's Platinum PCR SuperMix
  • PCR used to amplify the kan cassette
  • Reagents
  • KAN cassette, pZE22g plasmid:
    • 1µL hisura-kan-f (5µM) (made by 1:20 dilution of 100µM stock)
    • 1µL kan-r (5µM) (made by 1:20 dilution of 100µM stock)
    • 1µL pZE22g (1:100 dilution of glycerol stock culture)
    • 22.5µL of invitrogen's Platinum PCR SuperMix
  • Parameters:
• 1) 94°C for 2 min (denature template, activate enzyme)
• 2) 94°C for 30 sec (denature)
• 3) 53°C for 30 sec (anneal)
• 4) 72°C for 2 min (extend)
• 5) Repeat 2-4 for 25 cycles total
• 6) 72⁰C for 5 min
• 7) 4°C forever

PCR Purification:

• Used the Qiagen PCR purification kit and instructions in order to purify the Kan cassette and selections construct PCR products
  • Nanodrop the purification results and observed 3 ng/µL for Kan cassette and 29.8 ng/µL for ZFB-wp-His3: purification did not work well, especially for the kan

Selection strain (ΔHis3ΔPyrFΔrpoZ):

• saturated overnight culture was inoculated again: 3mL LB, 3µL tet, 30µL of overnight culture, at 37C until mid-log
• glycerol stock
• For transformation tomorrow we grew up pKD42 in 3 mL of LB, 1.5 µL of ampicillin(2000x) and one colony at 30 C
  • Also grew up more of the selection strain so it will be ready for electroporation transformation

Gel

• Ran gel with Kan cassette and selection construct (Binding site, His3, and URA3)
  • Observations successful and image below
  • Used 1 kb plus ladder

PCR Overlap

• since the purification was not very successful, we used 3µL saved from the original PCR product
• Procedure
  • 25µL of 2x Phusion Master Mix
  • 1 µL of ZFB-wp-HisURA-R (100µM)
  • 1µL of HisURA-Kan-F (100µM)
  • 21 µL of water
  • 1 µL Kan template and 1 µL of ZFB-wp-His3-URA3
    • 4 tubes
      • Both undiluted
      • Both 1:10 dilution
      • Both 1:100 dilution
      • Both 1:1000 dilution
• Protocol
  • 98 C for 30 s
  • 98 C for 10 s
  • 53 C for 30 s
  • 72 C for 3 min
  • Repeat steps 2-4 for 24 more cycles
  • 72 C for 5 min
  • 4 C 4EVA!!!

June 15th - Bioinformatics

• We continued research into Persikov's and others' work on binding.

• We worked on using the OPEN data to test Persikov's binding-predicting program: SVM

• Justin continued work on a sequence-finding program, the most up to date version can be found in the Dropbox under code/zfsitefinder.html.
• Justin and Will found 10 candidate sequences across 4 diseases that hopefully should encompass a good amount of diversity in terms of expanding the ZF library. These sequences can be found in the table below, with more details here.

Disease	Target Range	Binding Site Location	Bottom Finger	Top Finger	Bottom AA (F3 to F1)	Top AA (F3 to F1)
Colorblindness	chrX:153,403,001-153,407,000	370	GTATTTGTT	GGGCCTGCT	N/A	N/A
Colorblindness	chrX:153,403,001-153,407,000	3627	GCTGGCTGG	GCGGTAATG	EGSGLKR.EAHHLSR.#######	RRDDLTR.QRSSLVR.#######
Cystic Fibrosis	chr7:117,074,084-117,089,556	14767	GCAGGTGAT	AAAGAGCCC	QNGTLGR.EAHHLSR.#######	N/A
Familial Hypercholesterolemia	chr19:11,175,000-11,195,000	14001	GGCTGAGAC	GGAGTCCTG	ESGHLKR.QREHLTT.#######	QTTHLSR.DHSSLKR.#######
Tay-Sachs	chr15:72,674,944-72,688,031	5888	GTCTGGTCA	TCAAACTCC	DRSSLRR.RREHLTI.#######	N/A
Pancreatic Cancer	chr7:117,074,084-117,089,556	1739	GATCAAGCT	GTTTCAGTG	N/A	N/A

• We collected 15 alternative zinc finger backbones (different from zif268 backbone) and their corresponding base sequences. Many of these were from Persikov 2011 and all binding sequences were confirmed on the [http://www.pdb.org/pdb/home/home.do Protein Data Bank website]. The zinc finger PDB ID's and related links are:

PDB ID	Binding Sequence	Link
1F2I	ATGGGCGCGCCCAT	[http://www.pdb.org/pdb/explore/explore.do?structureId=1F2I]
1G2D	GACGCTATAAAAGGAG	[http://www.pdb.org/pdb/explore/explore.do?structureId=1G2D]
1G2F	TCCTTTTATAGCGTCC	[http://www.pdb.org/pdb/explore/explore.do?structureId=1G2F]
1MEY	ATGAGGCAGAACT	[http://www.pdb.org/pdb/explore/explore.do?structureId=1MEY]
1TF6	ACGGGCCTGGTTAGTACCTGGATGGGAGACC	[http://www.pdb.org/pdb/explore/explore.do?structureId=1TF6]
1UBD	AGGGTCTCCATTTTGAAGCG	[http://www.pdb.org/pdb/explore/explore.do?structureId=1UBD]
1TF6	ACGGGCCTGGTTAGTACCTGGATGGGAGACC	[http://www.pdb.org/pdb/explore/explore.do?structureId=1TF6]
1YUI	GCCGAGAGTAC	[http://www.pdb.org/pdb/explore/explore.do?structureId=1YUI]
2DRP	CTAATAAGGATAACGTCCG	[http://www.pdb.org/pdb/explore/explore.do?structureId=2DRP]
2GLI	TTTCGTCTTGGGTGGTCCACG	[http://www.pdb.org/pdb/explore/explore.do?structureId=2GLI]
2I13	CAGATGTAGGGAAAAGCCCGGG	[http://www.pdb.org/pdb/explore/explore.do?structureId=2I13]
2KMK	CATAAATCACTGCCTA	[http://www.pdb.org/pdb/explore/explore.do?structureId=2KMK]
2PRT	CGCGGGGGCGTCTG	[http://www.pdb.org/pdb/explore/explore.do?structureId=2PRT]
2WBS	GAGGCGC	[http://www.pdb.org/pdb/explore/explore.do?structureId=2WBS]
2WBU	GAGGCGTGGC	[http://www.pdb.org/pdb/explore/explore.do?structureId=2WBU]

June 16th - Wet Lab

• There was totally a crazy bee hive outside today!!

Glycerol Stock pKD42

• Grew up pKD42 in 30 C and once reached mid-log created glycerol stock and placed in -80 refrigerator

Overlap PCR gel

• Ran gel to test if overlap PCR that ran through the night worked, and it did not
  • Used PCR product without purification which gives good explanation for why it didn't work

• PCR: Since the PCR done the previous day (6/15) we made a back up PCR using phusion mastermix (Finnzyme)
  • PCR used to amplify section of plasmid containing zinc finger binding site, weak promoter, His3, and URA3 (with homology to join it to kan cassette)
  • Reagents
  • zinc finger binding site and weak promoter, selection construct plasmid:
    • 1µL ZFB-wp-f (100µM) (taken directly from the primer tube)
    • 1µL ZFB-wp-hisura-r (100µM) (taken directly from the primer tube)
    • 2µL selection construct (1:100 dilution of overnight culture)
    • 25µL Phusion High-Fidelity PCR Master Mix
    • 21µL distilled water (for total volume of 50µL)
  • PCR used to amplify the kan cassette
  • Reagents
  • KAN cassette, pZE22g plasmid:
    • 1µL hisura-kan-f (100µM) (taken directly from the primer tube)
    • 1µL kan-r (100µM) (taken directly from the primer tube)
    • 2µL pZE22g (1:100 dilution of glycerol stock culture)
    • 25µL of Phusion High-Fidelity PCR Master Mix
    • 21µL distilled water (for total volume of 50µL)
  • Parameters:
    • 1) 94°C for 2 min (denature template, activate enzyme)
    • 2) 94°C for 30 sec (denature)
    • 3) 53°C for 30 sec (anneal)
    • 4) 72°C for 2 min (extend)
    • 5) Repeat 2-4 for 25 cycles total
    • 6) 72⁰C for 5 min
    • 7) 4°C forever
• Ran PCR product on a gel: bands of the correct size were observed, though the kan band was much fainter than the ZFB-wp-his3

• Repeat PCR (to get a higher concentration of the Kan cassette and ZFB-wp-his3 constructs)
  • same as the above backup PCR (since it was successful), but to a 4x total volume of 200µL, compared to 50µL
  • PCR products were run on a gel: the correct bands were observed--see image below ("second gel")
  • PCR product purification: followed Qiagen kit instructions. Strangely, the conc. was 64.6 ng/µL for Kan, purity 2.09 (260/280) and for ZFB-wp-his3, the conc. was 23.7ng/µL and the purity was 1.92 (260/280).

Overlap PCR: used the kan cassette (64.6 ng/µL) and ZFB-wp-his3-ura3 (23.7 ng/µL) purified above

• 1 µL of kan and 1 µL of ZFB-wp-his3-ura in each tube according to the following conditions:
  • two tubes: undiluted
  • two tubes: both diluted 1 in 10
  • two tubes: both diluted 1 in 100
• 12.5µL Phusion master mix
• 8 µL ddH2O
• primers: 1.25 µL ZFB-wp-hisura_r (10 µM) and 1.25 µL hisura-kan_f (10 µM)
  • we tried two different reaction types: one added the primers as usual before starting the PCR reaction, the other added the primers after 10 PCR cycles (allowing the polymerase to first use the overlapping kan and ZFB to elongate, and then the primers)
• Parameters for PCR starting with primers:
  • (PCR machine 5, program name EXT3KB in IGEM folder)
  • 1) 98°C for 1 min (denature template, activate enzyme)
  • 2) 98°C for 15 sec (denature)
  • 3) 65°C for 15 sec (anneal)
  • 4) 72°C for 2 min (extend)
  • 5) Repeat 2-4 for 30 cycles total
  • 6) 72⁰C for 5 min
  • 7) 4°C forever
• Parameters for PCR starting without primers:
  • 1) 98C for 1 min
  • 2) 98C for 15 sec
  • 3) 65C for 15 sec
  • 4) 72C for 1 min
  • 5) back to step 2 for 10 cycles (PCR paused after 10 and primers added)
  • 6) 98C for 15 sec
  • 7) 65C for 15 sec
  • 8) 72C for 2 min
  • 9) back to step 6 for 20 cycles
  • 10) 72C for 5 min
  • 11) 4C forever

Transformation

• Used the selection strain (ΔHis3ΔPyrFΔrpoZ) cells at mid-log and attempted to place lambda red (pKD42) plasmid into the cell
• Procedure
  • Keep on ice through out whole procedure before use of the electroporation machine
  • Spin 1.5 mL of mid-log cells at 4 C for 1 minute at 18000 rcf (we created two tubes through the following steps)
  • Discard supernatant and resuspend with 1 mL of cold water
  • Spin again and repeat for a second water wash
    • With each wash, try to get as much supernatant out as possible(even use pipette) because don't want salts to interfere with the electrical pulse
  • Resuspend pellet with 50 µL of cold water
  • Add 1 ng of pKD42 to one of the tubes and 45 ng of pKD 42 to the other
  • Take all of the liquid in each tube and place in two separate cuvettes for electroporation
    • Make sure the electroporation machine is on the right setting (for the cuvettes we used today it was "Ec2")
    • Wipe off all water on the side of the cuvette
  • Have 1 mL of LB in hand and after pulsing, immediately put LB in cuvette
  • Transfer to culture tube and place in 30 C for 2 hours
  • Make 4 LB/amp plates and spread E. coli using glass beads:
    • Plate 1: 10 µL of 1 ng culture
    • Plate 2: take 700 µL of 1 ng culture, spin down and remove supernatant, resuspend in about 30 µL of LB and plate
    • Plate 3: 10 µL of 45 ng culture
    • Plate 4: take 700 µL of 45 ng culture, spin down and remove supernatant, resuspend in about 30 µL of LB and plate
  • Grow overnight at 30 C

PCR to confirm knockouts of selection strain

• this PCR was to confirm that the ΔHis3ΔPyrFΔrpoZ was indeed a knockout for the His3, PyrF, and rpoZ genes
• each primer set was used for two conditions: wild-type (we used a pKD42 culture) and knockout (ΔHis3ΔPyrFΔrpoZ culture, left over from transformation)
• 1 µL of either wt or ko template, diluted 1:20
• 12.5 µL Phusion master mix
• 1.25 µL of each 10µM primer:
  • test for His3:
    • 1)His3_F, His3_R
    • 2)His3_F, His3_internalR
  • test for PyrF:
    • 3)PyrF_F, PyrF_R
    • 4)PyrF_F, PyrF_internalR
  • test for rpoZ:
    • 5)rpoZ_F, rpoZ_R
    • 6)rpoZ_F, rpoZ_internalR
  • test for Zeocin (there are two primer sets because we don't know what orientation the Zeocin gene is in)
    • 7)Zeocin_R, rpoZ_F
    • 8)Zeocin_R, rpoZ_R
• ddH2O up to 25 µL
• Parameters:
  • 98 C for 5 min
  • 98 C for 10 sec
  • 65 C for 25 sec
  • 72 C for 45 sec
  • cycle 30 times
  • 72 C for 5 min
  • 4 C forever
• Results: ran PCR products out on 1% gel (see below). There were some nonspecific bands, but the PyrF and rpoZ genes do appear to be knocked out in the selection strain. His3, however, looks like it's still present--we'll test again to confirm.

June 16 - Bioinformatics

• Research Targets

1. Clinically relevant targets
2. Existing ZFs that bind under-represented triplets

Updating our programs

• Many of our current programs currently look at overall data or data based on specific DNA triplets (for example: 'GAT' or 'AAA'). However, in order to more easily understand some of the patterns that occur in the datasets, we want to examine broader subsets of data. For example, do different patterns appear when looking at fingers that bind to 'GNN' triplets versus 'NGN' triplets (where 'N' represents any of the 4 bases)?
  • We added the capability for our programs to accept inputs with the variable 'N' by using regular expressions.
    • We can now create lists of the zinc fingers that bind to any triplet, and create interaction matrices and frequency tables for any triplet input.

June 17th - Wet Lab

Update on selection strain knockout status: We are trying to reach Addgene to check how His3 was knocked out---instead of deleting the gene, they may have simply introduced an early stop codon. If that's the case, our gel would have the correct bands because the primers we designed can only show whether a deletion or insertion was in that locus.

Transformation results: successful!!

• The only plate with colonies was the one plated with 700 µL of cells transformed with 45 ng of pKD42
• Chose a colony to grow in 3mL LB, 1.5µL amp, 30C; make glycerol stock with mid-log cells
• Plate with colonies at 4C

Miniprep of pZE22G: (to have the plasmid containing the kan cassette on hand)

• used 2 tubes of 1.5mL overnight culture, followed Qiagen kit instructions
• 38.0 ng/µL, 260/280=1.99
• 27.8ng/µL, 260/280=2.02

Overlap PCR gel and extraction: 1%, 150V

• Results: adding the primers in after 10 cycles was much more successful than adding them at the beginning, and all three dilutions showed the expected product band (about 2.5kb). The rest of the 1:10 dilution will be run on a gel and extracted.
• 11.2ng/µL, 260/280=2.10

June 17 - Bioinformatics

Goals

1. Make BB Database in program-readable format ✓
2. Edit out BB with incomplete helices ✓
3. GNN, TNN, CNN, ANN frequencies

• Targets (5-10; 8) x Backbones (???) x Helices (≥500)=55,000
  • Backbones: similar, but not too similar to zif268; more than 1-2 aa changes, but <10
  • Helices fixed based on our program-- eventually saturates and levels out
    • Graph: # of var (# of tries by the computer) vs. % space covered

Options for Target DNA Sequences / ZF Helices

1. F3(known) / F2(known) / F1(novel)
2. F3(known) / F2(SNP in b₁ position) / F1(known)
3. F3(unknown) / F2(unknown) / F2(unknown)

• Excluded Rare Codons (for E. coli)CodonUsage OpenWetWareCodonUsage NIHRareCodonCalculator:
  • CTA
  • ATA
  • CCC
  • CGA
  • CGG
  • AGA
  • AGG
  • GGA
  • GGG

---

References

1. Persikov2011 pmid=21572177
2. CodonUsage http://www.sci.sdsu.edu/~smaloy/MicrobialGenetics/topics/in-vitro-genetics/codon-usage.html
3. OpenWetWareCodonUsage http://openwetware.org/wiki/Escherichia_coli/Codon_usage
4. NIHRareCodonCalculator http://nihserver.mbi.ucla.edu/RACC/

June 20th - Wet Lab

• Grew up colony of the selection strain with pKD46 in an attempt to reach mid-log and create glycerol stock
  • Unable to reach mid-log, so going to leave growing over night and use saturated culture tomorrow
• Determined primers in order to piece together the omega subunit and ZFP genes into the pZE21G plasmid (spec cassette)
• Ran PCR on His3 locus and sent to GENEWIZ to be sequenced
  • used the same procedure as the earler WT/KO PCR, but with 1µL undiluted template and only His_F and His_R primers
  • ran 3 reactions and sent in three primers (His_F, His_R, His_internalR)

June 20th - Bioinformatics

Goals for the week

• Finish designing the chip, by Wednesday hopefully
  • Need chip order out, takes 4 weeks
  • Need all sequences by Friday!!!
• FIRST PRIORITY: If we can get Persikov to work, good!
  • Step one: get results he’s published, get the web app to "work" with his data, then OPEN data, and finally our data
• Brainstorming session (tomorrow?) to decide how many targets/sequences
• Determine the importance of the first/second/third nucleotide positions
  • Look at NGN, NTN, NAN, NCN (Not just GNN, etc.)
  • Pick a particular GNN, plot vs. TNN- is there a pronounced difference in position 1, or -1?

Today

• Testing Persikov's Data for validation
  • Persikov v. himself ✓
  • Persikov v. OPEN
  • Persikov v. our sequences

Probability data

• The following are graphs of the probability of finding each amino acid at each position on the alpha helix.

Probability data for the 783 fingers that bind to GNN triplets. Note the high probability of leucine at position 4 and arginine at position 6.	Probability data for the 128 fingers that bind to TNN triplets. Note the high probability of leucine at position 4.	Probability data for the 16 fingers that bind to CNN triplets. There may not be enough data to consider this information statistically significant	Probability data for the 29 fingers that bind to ANN triplets. There may not be enough data to consider this information statistically significant
Probability data for the 298 fingers that bind to NGN triplets. The position 4 leucine motif remains. There is also a high probability (> 0.5) of a histidine at position 3 and an arginine at position 6.	Probability data for the 177 fingers that bind to NTN triplets. The position 4 leucine motif remains.	Probability data for the 244 fingers that bind to NCN triplets. The position 4 leucine motif remains. There is also a very high probability of an arginine at position 6.	Probability data for the 248 fingers that bind to NAN triplets. The position 4 leucine motif remains. There is also a very high probability (> 0.75) of an asparagine at position 3 and an arginine at position 6.
Probability data for the 234 fingers that bind to NNG triplets. The position 4 leucine motif remains. There is also a very high probability (> 0.75) of an asparagine at position 1 and a high probability (> 0.5) of an aspartic acid at position 2 and an arginine at position 6.	Probability data for the 247 fingers that bind to NNT triplets. The position 4 leucine motif remains. There is also a high (> 0.5) probability of an arginine at position 6.	Probability data for the 262 fingers that bind to NNC triplets. The position 4 leucine motif remains. There is also a very high (> 0.75) probability of an arginine at position 6.	Probability data for the 218 fingers that bind to NNA triplets. The position 4 leucine motif remains. There is also a very high (> 0.75) probability of a glutamine at position -1 and an arginine at position 6.

June 21st

Wet Lab

His3 sequencing results:

The sequencing results showed that the His3 (HisB) gene is still present in the strain and without any early stop codons. There is a 2 aa deletion in the middle of the protein, but its purpose is unknown and the gene likely is still fully functional.

• Restreak selection strain on plate from glycerol stock--tomorrow we will PCR the His3 locus and sequence again just to be sure.
• Made oligos for MAGE to insert stop codons and make a frame shift in the endogenous His3 gene, so that if necessary we can knockout His3 ourselves.

Selection strain with lambda red:

• Reinoculated and made glycerol stock
• prepared for MAGE tomorrow

June 21st - Bioinformatics

Persikov Statistics - Graphs

Scatterplot of top/bottom 20 with SVM polynomial

Sequence by sequence (lin SVM)

Top/Bottom 20 ZFs (SVM linear)

Comparison of polynomial vs. linear distribution (polynomial generally higher values)

• FQCRICMRNFS_{zif268 F2 Backbone}/Helix F1/TGEKP_linker

• The Persikov data shows weak predictive power for OPEN amino acid sequences. Our conclusion is that Persikov's program is not well-suited for incorporation into our helix generator. Testing Persikov's helices in his program yeilded mostly accurate results (approximately 24/25 matched known binding information). This is an important test because it proved that we are using the program correctly and that the program is in fact working properly. However, testing the OPEN sequences in Persikov's program resulted in numerous false negative values which informed our decision not to use Persikov's program to check our own hellix-generating program.

Phone Call with Dan

• How conservative/risky should we be in terms of using other backbones?
  • Conservative
    • Possible Pros:
      • More likely to get something that will work
      • Depending on how "smart" our probabilities are (from our ZF generation algorithm), we could cover a lot of novel space without straying too far from zif268
      • Worst Case:Something we can show for iGEM (we covered the same ground OPEN did, and found many of the same ZFs, but with a targeted approach, a "smarter" method-- not throwing random things at it; Chip is not ours, but the program is "smarter")
    • Possible Cons:
      • Might end up covering the same ground as OPEN, but doing a "worse" job than they did
      • Less likely to discover new/groundbreaking things (i.e., TNN triplets)
  • Less Conservative
    • Have 3-6 target sequences (we're currently going for 8)
    • More backbones from non-zif268 than zif268
    • Pros:
      • We could get luck and find something no one has ever seen before (TNN, ANN). If we throw enough things at it, we're more likely to get luck.
    • Cons:
      • Risk: Many of these backbones (from entire ZF world)may NOT bind DNA (i.e., may bind proteins)
      • Risk: May not find anything that binds, then the whole project is a dud
• What is the more important variable, helices or backbones?
  • Helices seem to be more important, backbones of secondary importance
  • Backbones: ZF's unravel DNA, open the major groove-- backbone is important here, changes the bond angle, etc. (Brandon's paper-??)
• Balance needed between low and high risk
  • If we find backbones that we know bind DNA, greatly lowers our risk
  • Limited spaces on chip: zero-sum game
  • With a middle of the road approach, we diminish both benefits and risk (diminishes the benefits of the high risk approach much more than it diminishes the benefits of the conservative approach; i.e., if you're playing the lottery, you're more likely to win if you buy many more tickets)
• We need to compare probabilities of randomly-generated OPEN sequences vs. probabilities of sequences randomly generated by our program
  • OPEN tries to cover all space: smaller probability
  • If we have a "smarter" algorithm, we can produce fewer
  • However, the idea is not to repeat OPEN, but to go somewhere else, non-GNN sequences
  • Remember: OPEN is a Cell paper; the point of the project is not to compare ourselves to them
• If we find binders for 1-2 of our sequences, that would be awesome
  • Probably we'll have some that find none, some have 10, our last one might have 1,000 hits (then, we do bioinformatics to figure out why/what those hits were)
  • Point: to learn and do high-level bioinformatics, and high-tech cloning techniques in the lab
  • If you do find binders, you can write a paper about it!
• We have all the resources we need right now to build our chip
  • We need to pick out targets
  • Need to decide exactly what we want for:
    • No. of target sequences/which ones
    • No. of helices/ which ones
    • Ratio of zif268 backbones: non-zif268 backbones
  • Avoid switching Leucine out of position 4, then change other positions based on our frequencies

Chip Design

• No. of sequences will be more than we can put on the chip
  • Helices: essentially unlimited
    • Put more-likely-to-bind helices into the risky backbones
    • Put less-likely-to-bind helices into a zif268 backbone
• Backbones
  • Maybe revert to a more targeted approach: pick backbones that we know are transcription factors (TFs), that we know bind to DNA
  • OR research the ZFs from the phylogenetic tree
    • Pick clades to research, see if one looks better than the other
  • Why did OPEN cover so many helices, without changing the backbone, but still yield predominantly GNNs?
  • If we have an idea of how the backbone might affect binding, maybe we could look into some sort of low-level modeling, etc. so that we wouldn't be grasping? Could Vatsan help with this?
    • See 2000 Wolfe paper [http://www.ncbi.nlm.nih.gov/pubmed/10940247]
  • Backbones could affect interactions between fingers
  • Theory: energy penalty to ZF binding-- unravels DNA when binds to it
• We have 12 target sequences
  • 2 per 4 diseases, 4 for the 5th disease
  • If we want to be more conservative, we could throw out Type III, but it could be something cool
  • We should have mostly Type I (CoDA argument, if this is an F2)
  • Proposed: 3 diseases, 6 sequences
    • 4 Type I (F3 and F2 known, F1 novel)
    • 1 Type II (GNN, ANN, GNN)
    • 1 Type III (All unknown, e.g., TNN, ANN, TNN;max 1)

Or, for 3 diseases:

1. Type I's
2. Type I, Type II
3. Type I, Type III

• Clinical Targets

1. Colorblindness (Type I's)
2. Familial Hypercholesterolemia (FH) (1 in 500)
3. Cystic Fibrosis (CF)
4. Tay Sachs
5. KRAS- (oncogene/cancer)

• Main goal of project: to build outside of what is already known
  • If we wanted to cure a disease only, we could just use existing ZFs (i.e., find GNN binding locations)
  • Also, we lend a level of specificity for insertion/deletion
  • There is the possibility that there might be some area where specificity might demand ANN codons

Current decision on chip design:

• We will have 6 target sequences, 2 each from colorblindness, FH, and KRAS. All are "Type I" targets (only F1 is novel) with the middle finger chosen from the CODA paper (either GNN or TNN)
  • N.B.: the CB and FH sequences make up full ZF nuclease cut sites. The KRAS sites, due to the small number of GNNTNN F3F2 combos available in CODA, are separate, with the flanking ZF nuclease site added afterwards in parentheses

1. GGTGGTAAG (CB)
2. GGAGTCCTG (FH)
3. GGCTGATGC (KRAS) (CTGAAAATT)
4. GGCTGACAC (FH)
5. GGCTGGAAT (KRAS) (GACAAGAGC)
6. GTCGCCTCC (CB)

• Targets 3, 4, and 6 are similar to sequences Zif268 variants successfully bind to, so the backbones will be weighted accordingly:
  • Zif268_F2 backbone: 6000 helices (per target)
  • 10 backbones more closely related to Zif268: 300 helices each
• Targets 1, 2, and 5 will have equal distributions of backbones:
  • Zif268_F2: 3000 helices
  • 10 backbones closely related to Zif268: 300 each
  • 10 backbones more distantly related to Zif268: 300 each

Identifying dependencies

• We looked at the probability graphs to determine which amino acid positions on the finger's helix interact with which bases.
  • Some interactions are fairly well estabilished, while others have been more recently proposed (See interaction map (Persikov 2011))
  • To identify these interactions in our own data we looked at which helix positions varied most when you changed the bases. A more rigorous way to do this is to calculate the entropy change as you change the amino acids in each position.
    • xNN(Vary base 1): Amino acid 6 changes
    • NxN(Vary base 2): Amino acid 3 changes
    • NNx(Vary base 3): Amino acid -1 and 2(?) changes
  • Our program looks at dependencies between amino acids when generating sequences.
    • We decided on these amino acid dependencies, using both established data and patterns we saw in the OPEN data:
      • -1 and 2
      • 2 and 1
      • 6 and 5
  • Because there is not much data for 'CNN' and 'ANN' sequences (with 16 and 29 known fingers that bind to each triplet, respectively), we should use pseudocounts for these sequences, so that our frequency generator is not too biased toward probabilities that may not be significant.

June 22nd - Wet Lab

Preparing media/reagents for selection system:

• Made 0.1M zinc chloride solution, M9 salt, and 1M magnesium sulphate solutions for the amino acid mixture
  • M9 Salt solution (20x)
    • 67.8 g of disodium phosphate
    • 30 g of monopotassium phosphate
    • 5 g of sodium chloride
    • 10 g of ammonium chloride
    • All in 500 mL of distilled water
    • Sterile filtered when done dissolving

Overhang PCR for 3-part assembly of ZFs, omega subunit, and backbone vector (pZE21G, spec resistance)

• Clone out omega+Zif268:
  • template: original selection construct plasmid (ZFB, his3, etc.)
  • primers: omega_F+homolog, Zif268_R+homolog
  • Protocol
    • 98 C for 30 sec
    • 98 C for 10 sec
    • 68 C for 30 sec
    • 72 C for 30 sec
    • Repeat steps 2-4, 30 times
    • 4 C for ever
• Clone out omega only:
  • template: original selection construct
  • primers: omega_F+homolog, omega_R
  • Protocol
    • Same as omega + Zif268
• Clone OZ052 with overhang:
  • template: OZ052 overhang (overhang currently matches selection construct), 1:10b, 15ng/µL
  • primers: OZ052_F+omega homolog, OZ052_R+homolog
  • Protocol
    • Same as omega + Zif268
• Clone OZ123 with overhang:
  • template: OZ123 overhang (overhang currently matches selection construct), 1, 6.3ng/µL
  • primers: OZ123_F+omega homolog, OZ123_R+homlog
  • Protocol
    • Same as omega + Zif268
• clone out pZE21G backbone
  • template: pZE21G containing cells from plate, diluted 1:10
  • primers: back_F, back_R
  • Protocol
    • 98 C for 30 sec
    • 98 C for 10 sec
    • 68 C for 30 sec
    • 72 C for 1:30
    • Repeat steps 2-4, 30 times
    • 72 C for 5 min
    • 4 C for ever
• 25µL reaction:
  • 12.5µL Phusion mastermix
  • 1.25µL each primer
  • 1µL of 1ng/µL dilution of template
  • 9µL of ddH2O
• Ran gel of the above PCR products and imaged below: only the omega and omega+Zif268 reactions seemed to work

pZE21G backbone:

• 1 colony of pZE21G grown in 3mL LB, 3µL spectinomycin (1000x) until mid-log. Glycerol stock made.
• Miniprep of pZE21G in order to PCR the backbone: used Qiagen kit
  • 5ng/µL and didn't seem pure: miniprep (or nanodrop) not working
  • another colony used to start an overnight culture for PCR/glycerol stocks
• Ran gradient PCR on the miniprep product in order to obtain backbone
  • same protocol as before, with 1µL of template
  • 6 tubes spaced so that annealing temp=60,62,64,66,68,70
• Parameters: (program on PCR5, IGEM-> DOGGED)
  • 98°C for 30s (initial denaturation)
  • 98°C for 10s (denature)
  • 60°C to 71°C for 15s (anneal)
  • 72°C for 90s (extend)
  • Repeat steps 2-4 for 30 cycles total (denature, anneal, extend)
  • 72°C for 5 min
• 4°C forever

HisB locus PCR: We repeated the PCR of the selection strain at this locus just to be sure HisB is still present

• grew 1 colony from a new selection strain plate Vatsan brought in 0.5mL LB, 0.5µL tet
• used 1 µL of bacterial suspension for PCR following same procedure as 6/20

Lambda red to make selection system:

• grew ?His3?PyrF?rpoZ+pKD46 to mid-log (0.4 using OD)
• induced lambda red by shaking culture in 42C water bath for 15 min
• spin down 1mL for 1 min, 18000 rcf at 4C
• wash 2x with cold water, removing as much supernatant as possible
• resuspend with 200 ng kan-ZFB-wp-his-ura template (20µL) and water up to 50µL (30µL)
• electroporate using 1mm gap cuvettes adn 1.80KV. Immediately afterward add 1mL LB to cuvette, mix, and transfer to culture tube containing 2 mL more of LB
• recover for 2hrs, 30C
• spread on kanamycin plates: 100µL, 10µL, or 1µL (the last two dilute with 100µL LB to help spread more easily)
• grow overnight at 30C

June 22nd - Bioinformatics

Final target sequences

Our "tentatively" Final DNA Target Sequences (i.e. barring any major objections, we're going with this):

Disease	Target Range	Binding Site Location	Bottom Finger	Top Finger	Bottom AA (F3 to F1)	Top AA (F3 to F1)
Colorblindness	chrX:153,402,679-153,408,753	256	GGC TGA GGC	GTA GCT GGG	ESGHLKR.QREHLTT.#######	QSGTLTR.QRSDLTR.KKDHLHR
Colorblindness	chrX:153,402,679-153,408,753	2067	GAA GGG GAC	GGG GCT CAC	QDGNLGR.RREHLVR.EEANLRR	RTEHLAR.QRSDLTR.#######
Familial Hypercholesterolemia	chr19:11,175,000-11,195,000	2707	GGC TGG ATG	GGC TGG CTC*	ESKHLTR.RREHLTI.#######	ESKHLTR.RREHLTI.#######
Pancreatic Cancer	chr7:117,074,084-117,089,556	4423	GCA GAC TGT	GCA GGA AAA	QGNTLTR.DRGNLTR.#######	QDVSLVR.QSAHLKR.#######

• Drier was unable to find a ZF that bound specifically to CTC. Instead he found zinc fingers that bound to CTC and other sequences with equal binding affinity.
• Note: The green cells are the target sequences that we are aiming for on our chip.

Finalizing the non-Zif268 backbones

In addition, we locked down the non-Zif268 backbones that we will be using for the chip. We have 10 backbones that are more closely related to Zif268, and 10 that are more distantly related:

More Closely Related Backbones			More Distantly Related Backbones
Name	Sequence (with helix)		Name	Sequence (with helix)
44GLAS_DROME	FRCPI---CDRRFSQSSSVTTH-MRTH--		56EGR1_HUMAN	FAC---DICGRKFARSDERKRHTKIH---
38KRUP_DROME	FTCKI---CSRSFGYKHVLQNH-ERTH--		47MZF1_HUMAN	FVC---GDCGQGFVRSARLEEHRRVH---
124EVI1_HUMAN	YRC---KYCDRSFSISSNLQRHVRNIH--		23CF2_DROME	YTC---SYCGKSFTQSNTLKQHTRIH---
6HUNB_DROME	YECK---YCDIFFKDAVLYTIHMGY--H-		19ZEP2_RAT	YICE---ECGIRCKKPSMLKKHIRTH---
16SUHW_DROME	FPCEQ---CDEKFKTEKQLERH-VKTH--		49SDC1_CAEEL	VVC---FHCG-TRCHYTLLHDHLDYCH--
125CF2_DROME	YTC---PYCDKRFTQRSALTVHTTKLH--		27SDC1_CAEEL	LTC---AHCDWSFDNVMKLVRH-RGVH--
43EVI1_HUMAN	FKCHL---CDRCFGQQTNLDRH-LKKH--		130TTKB_DROME	YRC---KVCSRVYTHISNFCRHYVTSH--
118ADR1_YEAST	YPC---GLCNRCFTRRDLLIRHAQKIH--		80ESCA_DROME	YQC---PDCQKSYSTFSGLTKH-QQFH--
24EVI1_HUMAN	QECK---ECDQVFPDLQSLEKHMLS--H-		20IKZF1_MOUSE	HKCG---YCGRSYKQRSSLEEHKERCH--
25SUHW_DROME	MSCKV---CDRVFYRLDNLRSH-LKQH--		127SRYD_DROME	QECTT---CGKVYNSWYQLQKHISEEH--

Updated Chip Design

The CODA article produced zinc fingers that bound a GNN or TNN F2 with either a ANN, GNN, or TNN F3. These results lead us to the following distribution of three types of zinc finger backbones (Zif268, similar but not equal to Zif268, and dissimilar to Zif268) across our 6 target DNA sequences. With 55,000 spaces on our chip, each of the 6 target DNA sequences is allotted 9,150 spaces with 100 spaces set aside for control zinc fingers from CODA and OPEN. Note that the values in the table below represent the number of helices inserted into each type of backbone.

Disease	Target DNA Finger 2	Target DNA Finger 1	Helices in Zif268 Backbone	Helices in Zif268 Closely-Related Backbones	Helices in Zif268 Distantly-Related Backbones
Colorblindness	TNN	GNN	5150	3000	1000
Colorblindness	GNN	CNN	3050	3050	3050
Familial Hypercholesterolemia	TNN	ANN	3050	3050	3050
Familial Hypercholesterolemia	TNN	CNN	3050	3050	3050
Pancreatic Cancer	GNN	TNN	5150	3000	1000
Pancreatic Cancer	GNN	ANN	3050	3050	3050

N.B.: The chip will only be holding our F1 zinc fingers- the F2 and F3 will be on a separate plasmid that we must make ourselves

To Do: The distribution of helices to each backbone set/target sequence needs to be finalized. For example, the program can generate a set of helices for the Zif268 backbone to be applied to the colorblindness target sequence, but should the same set or a completely different helix set be applied to the Zif268 backbones for the familial hypercholesterolemia target sequences?

• If we want to test the effect of the backbone, would need to keep the helices constant-- but we could do this within a single target, to keep all other variables constant

Finishing the generator

We finished and finalized the program that generates zinc finger sequences. The following changes were made today:

• We incorporated the data from Persikov's database into out generator.
• We included the ability to remove duplicate sequences in the output file (with a dictionary).
• We added pseudocounts for fingers that bind to 'ANN' or 'CNN' targets. Because there is not much information for these targets, the data we do have may be biased. Thus, we want to make sure that amino acids that currently have no probability of occurring are bumped up to a minimum (currently 0.01).
• We placed additional weight on non zif-268 backbones. Formerly, the amino acids for positions 1, 4, and 5 were fixed based on zif-268 data, regardless of the original helix sequences on these backbones. Now information from both zif-268 and the original helix sequence is considered when assigning weights to the amino acids.
• We started working with Noah's reverse translate program.

We tested our generator to ensure that the sequences it was producing appeared to be legitimate.

• Jamie looked at the multiple sequence alignments of the fingers generated, so see if the frequencies correlated with what we expected them to be. (?)
• We input a known DNA triplet to see if the program generated sequences known to bind, according to OPEN data. When generating 10000 sequences, about half the known binders for the input triplet were found.

We created [http://weblogo.berkeley.edu/ WebLogos] to more easily visualize how adding the Persikov data affects the sequences we generate. The size of the letters correspond to the frequency of that amino acid in that position. We decided to incorporate the Persikov data so that our generator incorporates more information when generating sequences. Doing so does not drastically change the sequences generated.

WebLogo for the OPEN data.	WebLogo for the Persikov data.
WebLogo for 10000 sequences generated with our program, when it incorporates only OPEN data.	WebLogo for 10000 sequences generated with our program, when it incorporates both OPEN and Persikov data.
WebLogo for fingers that bind to ANN according to OPEN data.	WebLogo for 10000 sequences generated for an ANN triplet with our program, when it incorporates only OPEN data.	WebLogo for 10000 sequences generated for an ANN triplet with our program, when it incorporates both OPEN and Persikov data.

June 23rd - Wet Lab

Ran gel to determine the results of the PCR products

• Determined the HisB presence in selection strain
  • Finalized the presence of hisB through the gel image below
• Determined the success of the pZE21G backbone primers through gel on gradient PCR
  • PCR for the backbone failed again, even done through gradient PCR

PCR more Kan-ZFB-His3-Ura3

• Two 50 µL reactions
  • Doubled the protocol used on the 16th and used HisUraKan_F and ZFBwpHisUra_R primers
  • PCR produced very low concentration of Kan-ZFG-His3-Ura3 because melting temperature of primer was too high, so primers stuck to annealing DNA and did not dissociate
    • In image below the low concentration of desired product can be seen, along with the high concentration of unused primers

• Ran gel of initial overlap PCR product (undiluted, starting without primers) from June 16th, using whole sample
• Performed gel extraction in order to have more Kan-ZFB-His3-Ura3 product for the transformation tomorrow: 8.5ng/µL, 260/280=2.03

Determined success of the selection construct transformation

• Checked the plates all day,and finally came to the conclusion that the transformation did not work
• Discovered that lambda red has a promoter induced by arabinose, not temperature (though the strain is still temperature sensitive). That is why it didn't work--we'll get arabinose and hopefully have a successful recombination.
• Preparing all parts for transformation today and will finish it tomorrow

Oligo Design for MAGE

• Designed 90bp long oligos for OZ052 and OZ123 insertion in the ZFB sites in place of Zif268. Reverse complement taken.

Miniprep pZE21G plasmid for backbone PCR

• Ran miniprep again for pZE21G plasmid: 6ng/µL, 260/280=2
• Worried that the miniprep didn't work: ran gel also on this miniprep and concluded that DNA was present in the sample
  • Gel image seen below

Ran PCR for pZE21G backbone

• Used same protocol from June 22 in PCR today for pZE21G backbone

June 23rd - Bioinformatics

Revising Target Sequences

Target DNA	Cystic Fibrosis	Familial Hypercholesterolemia	Retinal Blastoma	p53	Myc	Pancreatic Cancer
GNN A	Flank 1					?
GNN T	Flank 1
GNN C	?	Flank 2
TNN G		Flank 2			X
TNN C		Flank 3			?
TNN A		Flank 3			?

This is the set of final, final target sequences based on the table above:

Disease	Target Range	Binding Site Location	Bottom Finger	Top Finger	Bottom AA (F3 to F1)	Top AA (F3 to F1)
Colorblindness	chrX:153,403,001-153,407,000	3627	GCT GGC TGG	GCG GTA ATG	EGSGLKR.EAHHLSR.#######	RRDDLTR.QRSSLVR.#######
Familial Hypercholesterolemia	chr19:11,175,000-11,195,000	14001	GGC TGA GAC	GGA GTC CTG	ESGHLKR.QREHLTT.#######	QTTHLSR.DHSSLKR.#######
Myc-gene Cancer	chr8:128,938,529-128,941,440	198	GGT GCA GGG	GGC TGA CTC	VDHHLRR.QSTTLKR.RRAHLQN	ESGHLKR.QREHLTT.#######
Myc-gene Cancer	chr8:128,938,529-128,941,440	981	GGA GAG GGT	GGC TGG AAA	QANHLSR.RQDNLGR.TRQKLET	EKSHLTR.RREHLTI.#######

• Green cells are our target sequences.

June 24

• Designed primer for testing HisB deletion, reuse His_Internal_R to test the band

pZE21G:

• reinoculated culture with 100µL of saturated solution, grew to mid-log, and made glycerol stock
• backbone PCR: ran E gel but no bands--PCR unsuccessful. We may need to use a different backbone for the zinc fingers.

Omega and Omega+Zif268:

• these were the only two PCR reactions from 6/22/11 to work
• PCR purified using Qiagen kit:
  • omega: 6.1ng/µL, 260/280=1.83
  • omega+Zif268: 11.3 ng/µL, 260/280=1.67

Lambda red recombination of selection system:

• reinoculated selection strain+pKD46 with 100µL of saturated solution
• just before mid-log (about 4 hours after inoculation) divided culture in half (1.5mL) and added either 37.5µL or 3.75µL of 20% arabinose solution (to try two different induction levels). Cultures grew for another hour.
• The rest of the procedure was the same as the 6/22/11 attempt but without the 42C water bath.

June 24th - Bioinformatics

Playing with Pseudocounts

Using CTC because of position 6's reliance on the CNN frequencies, we see what difference values of pseudocounts (if in the frequency table, the frequency of an amino acid is 0, bump it up to the psuedocount: ex. A = 0 becomes A = .015 with a psuedocount of .015) make. Pseudocounts are necessary for data that has small sample size - we could be missing out on working helices because a letter's frequency is 0 when it shouldn't be.

Various pseudocount (psu = ) values. Look at the 7th column, which is position 6 in the helix:

psu = 0	psu = .005	psu = .008
psu = .01	psu = .015.	psu = .020.

The variation from E being the top letter to A being top back to E is from a slight adjustment in how we add on psuedocounts: the 'new' way is a more proportional approach.

Notice how psu = 0 gives only the four letters found in our dataset, while psu > 0 adds in other letters, each with a small probability ranging from .5% to 2%.

The question is how much psu to add: less means we weight our (possibly flawed) data of proven zinc fingers more. Higher psu adds more randomness (variation) to our sequences, but some fraction of those sequences will not work.

Updated Closest Zif268 Fingers

We realized that some of our "close non-zif268 fingers" were actually not all that close to Zif268, and so we went into the 88,000 zinc finger database and pulled out zinc fingers surrounding zif268. In fact, there were many, many, many zinc fingers that had identical sequences to the Zif268 F2 finger, and so we looked at sequences around it. The tree below shows the new non-zif268 backbones that are actually close to zif268 compared to our old set. The new set is in gray, the old set is in black. This gives us a potential seven more backbones to work with.

Sequence Generation

We made some small updates to the sequence generator, based on the frequencies we noticed in the outputs of the tests we ran.

• We decided to only include pseudocounts for position 6 for 'CNN' and 'ANN.' Originally, 'CNN' and 'ANN' were using pseudocounts for all seven positions. However, this introduced a noticeable increase in amino acids, such as tyrosine (Y), that have been shown to occur rarely in zinc fingers (according to our data from OPEN and Persikov). Additionally, because tryosines occured so rarely in the data (11 times total in the open data set), we decided not to give tyrosine a pseudocount.
• We added the capability to prevent repeat backbone-helix combinations on the chip. That is, we wanted to make sure that the same exact zinc finger was not generated for different triplet inputs.

To test the sequence generator, we made two sets of 2000 sequences for GAA, then infographic-d the results. Comparing these with the images for OPEN and OPEN+Persikov shows that our generation follows the major themes of those datasets, but also introduces variation. The two generated sets also vary slightly from each other, which shows the influence of randomness on the generation.

Round 1 of generating sequences for GAA with the program.	Round 2 of generating sequences for GAA with the program.
GAA sequences from the OPEN dataset.	GAA sequences from Persikov and OPEN datasets.

Disease	Target DNA Finger 1	Helices in Zif268 Backbone	Helices in Zif268 Closely-Related Backbones	Helices in Zif268 Distantly-Related Backbones
Colorblindness (Bottom)	TGG	5150	3000	1000
Colorblindness (Top)	ATG	3050	3050	3050
Familial Hypercholesterolemia (Bottom)	GAC	5150	3000	1000
Familial Hypercholesterolemia (Top)	CTG	3050	3050	3050
Myc (Top198)	CTC	3050	3050	3050
Myc (Top981)	AAA	3050	3050	3050

Table of target sequences and helix distribution across backbones

• Distribution: Zif268 : Zif268 similar : Zif 268 dissimilar
  • Conservative distribution 56.3 : 32.8 : 10.9
  • Riskier distribution 33.3 : 33.3 : 33.3

List of Remaining Goals:

• Sort fingers by target
• Pick and assign primer sets
• Reverse translate fingers avoiding type II restriction enzymes and primers
• Append type II restriction enzyme and primer sequences to each finger
• Yay

June 25th-26th - Bioinformatics

This is the set of final target sequences with assigned forward and reverse primers (tags for PCR):

Disease	Target Sequence	Forward Primer (5'-3' NOT REVERSE COMPLEMENT)	Reverse Primer (5'-3' NOT REVERSE COMPLEMENT)
Colorblindness	GCT GGC TGG	ATATAGATGCCGTCCTAGCG	AAGTATCTTTCCTGTGCCCA
Colorblindness	GCG GTA ATG	CCCTTTAATCAGATGCGTCG	TGGTAGTAATAAGGGCGACC
Familial Hypercholesterolemia	GGC TGA GAC	TTGGTCATGTGCTTTTCGTT	AGGGGTATCGGATACTCAGA
Familial Hypercholesterolemia	GGA GTC CTG	GGGTGGGTAAATGGTAATGC	ATCGATTCCCCGGATATAGC
Myc-gene Cancer	GGC TGA CTC	TCCGACGGGGAGTATATACT	TACTAACTGCTTCAGGCCAA
Myc-gene Cancer	GGC TGG AAA	CATGTTTAGGAACGCTACCG	AATAATCTCCGTTCCCTCCC

Additionally, primer tags (forward: GTACATGAAACGATGGACGG, reverse:CTGGTATAGTCTCCTCAGCG) will be assigned to the 100 control sequences.

June 27

Wet lab

Sequencing PyrF, rpoZ loci:

• We will sequence these genes in the selection strain just to make sure they are knocked out, especially since it appears HisB is not.
• Picked a colony off ∆HisB∆PyrF∆rpoZ plate (6/21) and grew in 150µL LB plus tet in a 96 well plate for about 2 hrs at 37˚C
• diluted 1 in 20 and used 1µL as template in PCR with KAPA mastermix (see protocols for reagent amounts and parameters)
  • annealing temp 65˚C, elongation time 1:15

1. PyrF_F, PyrF_R primers
2. PyrF_F, PyrF_internalR
3. rpoZ_F, rpoZ_R
4. rpoZ_F, rpoZ_internalR
5. rpoZ_R, zeocin_R

• Run on E Gel to check PCR worked: bands are at the same sizes as the original genotyping gel.

• Tomorrow we will send samples to Genewiz for sequencing

Lambda Red recombination:

• The plates made from the recombination (6/24) did have colonies, but they were very small and took a long time to grow, and so they may not actually have the kan-ZFB insert. We will have to PCR the locus to see.
• Chose 8 colonies from each plate and grew at 30˚C in 150µL LB plus kan in a 96 well plate
• When our primers arrive, we will PCR the locus to check for the insert.

Selection system media:

June 27th - Bioinformatics

To Do for Today

1. 100 sequences (and control), 2 each with the same F3 and F2, but different F1, from our test sequences [zif268, OZ123, OZ052, CoDA]✓
2. Type II nuclease cut site sequences- put the binding sites into our oligos ✓
3. Final backbones with helices ✓
4. Programming stuff- Check to make sure there are no cut sites or primers in any of our backbone/helices combinations; check translation order (translates F1→F3)✓

100 Control Sequences

• See our Positive Control Sequences, updated June 28th
• Selected known binding zinc fingers from the CODA table that bind sequences similar to our target sequences
• All control helices from CODA were inserted into Zif268 F2 backbones and have been assigned a seventh primer tag separate from the tags given to the 6 target sequences.

Updated Target Sequences

One of our sequences from before was bad because the F3/F2 combo did not appear in the CODA table... faulty checking, my bad :(

Here is the newest table of target sequences:

Disease	Target Range	Binding Site Location	Bottom Finger	Top Finger	Bottom AA (F3 to F1)	Top AA (F3 to F1)
Colorblindness	chrX:153,403,001-153,407,000	3666	GTG GGA TGG	GAA GGG ACC	RNTALQH.QSAHLKR.#######	QDGNLGR.RREHLVR.#######
Familial Hypercholesterolemia	chr19:11,175,000-11,195,000	14001	GGC TGA GAC	GGA GTC CTG	ESGHLKR.QREHLTT.#######	QTTHLSR.DHSSLKR.#######
Myc-gene Cancer	chr8:128,938,529-128,941,440	198	GGT GCA GGG	GGC TGA CTC	VDHHLRR.QSTTLKR.RRAHLQN	ESGHLKR.QREHLTT.#######
Myc-gene Cancer	chr8:128,938,529-128,941,440	981	GGA GAG GGT	GGC TGG AAA	QANHLSR.RQDNLGR.TRQKLET	EKSHLTR.RREHLTI.#######

• Green cells are our target sequences.

Cut Site Design

• See our Cut Site Design page
• We left in one proline (P) between the linker and the starting FCQ... of finger 2, but as this proline is the last AA of the OPEN linker (TGEKP) and occurs before the beta sheet in every zinc finger in Zif268 (see zif268's sequence on its [http://www.pdb.org/pdb/explore/remediatedSequence.do?structureId=1AAY PDB page])
• This configuration also allows the library to be used at any finger position because proline ends the OPEN linker.

Updates on the program

The program appears to run extremely slowly because of the computationally intensive step of checking the reverse translated sequences

• In addition to checking for the primers and cutsites, we also have to check for 'GGGGGG' because it can lead to undesirable structures forming. In addition, we have to check for the reverse complements for all these undesirable sequences.
• We decided on a similarity of 0.8 as the maximum acceptable similarity between the sequence the primer bind to and any other part of the generated sequence. If the sequences are too similar, the primer might mishybridize. We originally had a similarity threshold of 0.6 but that made the program run too slowly, so we decided on a threshold of 0.8.

June 28th

Sequencing:

• the following samples from 6/27 were sent to Genewiz for sequencing:
  • PyrF F, R (one sample with PyrF_F, one with PyrF_R)
  • rpoz F, R (one sample with rpoz_F, one with rpoz_R)

Lambda red results:

• the colonies on the plates did not look promising, and the ones we chose and grew up in LB+kan did not actually grow. Just to be certain, we choose 18 more colonies: 6 from 37.5µL arabinose 100µL plated, 6 from 3.75µL arabinose 100µL plated, and 6 from 37.5µL arabinose 1.5mL plated. Three from each plate were grown in plain LB and three with kan. We will let it grow in 30˚C, overnight if necessary, and hopefully see bacteria for PCR.
• Assuming this does not work, we prepared more ∆HisB∆PyrF∆rpoZ+pKD46 in two ways: we put 3 colonies in LB+amp from the 6/16 transformation plate, and we streaked a new amp plate from the glycerol stock
• Another possibility is that something is wrong with our lambda red. We designed primers to verify that the pKD46 plasmid is really in the cells.

Kan-ZFB-wp-his3-ura3 construct:

• Our last few PCR purifications have given us very low yields, and consequently we have had to use large amounts of our DNA (and the large amounts of buffer salts may also be why our lambda red recombinations have failed). When we tried to amplify our current DNA using the hisura-kan_F and ZFB-wp-hisura_R primers and the Phusion mastermix, it did not work (see 6/23). We will try to gain more product in two ways:

1) Repeat 6/23 PCR but use KAPA mastermix

• the KAPA mix may work better than the Phusion.
• Used KAPA protocol with 1µL of kan-ZFB overlap as template, hisura-kan_F and ZFB-wp-hisura_R primers, 65˚C annealing temp, 90 sec elongation time
• made 2 reactions

2) Repeat overlap extension PCR (see 6/16) with KAPA mastermix

• used KAPA protocol with 1µL kan cassette and 1µL of ZFB-wp-hisura, 65˚C annealing temp, 90 sec elongation
• 10 cycles without primers; hisura-kan_F and ZFB-wp-hisura_R primers added; 15 more cycles
• made 6 reactions

• E gel to check reactions worked: all 6 overlap PCRs successful, but not the other two reactions.

• combined samples 1-3 and 4-6 and ran on 1% agarose gel for extraction

• used Qiagen gel extraction kit and instructions with the following modifications:
  • gel bands were dissolved in 500µL of buffer QG regardless of the gel volume
  • gel heated at 50C for 20 min (to make up for reduced amount of buffer QG)
  • after melting, 10µL of NaOAC (3M) were added to adjust the pH
  • DNA from samples 1-3 were eluted in 20µL of ddH2O; DNA from samples 4-6 were eluted in 20µL of buffer EB
  • water sample: 273.4 ng/µL, 260/280=1.92
  • EB sample: 136.9 ng/µL, 260/280=2.38

June 28th - Bioinformatics

Attention all Harvard iGEM-ers!!! According to the iGEM Main Page, our preliminary project descriptions and safety proposals are due on July 15. Please see the aforementioned link so we can get this done ASAP- we don't want to miss any deadlines and have all our hard work wasted!

• Finalized our Positive Control Sequences, using Justin's macro to insert the F1 helices into the appropriate zif268 F2 backbone

• Length of chip oligos: 131-140bp (based on Cut Site Design)
  • Primers: 20bp (x2= 40bp)
  • zif268 F2 backbone + helix= 23aa (x3=69bp; some fingers ~3aa longer)
  • Some alternate backbones are longer than zif268 F2 backbone
  • Type II binding/cut sites= 11bp on each side (22bp total)
  • Standard legnth: 40 + 69 + 22 = 131bp

• Use WebLogos as a final visual check of our final generated sequences

Plasmid and Oligo Design Schematics

Oligo Design

Expression Plasmid Design

Chip-Based Sequence Design Schematic

Chip-based process for sequence design, taken from Kosuri, et al. 2010 model of scalable gene synthesis Kosuri2010

References

<biblio>

1. Kosuri2010 pmid=21113165

</biblio>

Harvard Logo

Running the Generator!

File:HARVFasta total.csv NOTE: LATER GENERATED NEW SEQUENCES. NOT UP TO DATE.

Generated Final Chip Sequences

• We ran the generator once earlier this afternoon, but had to re-run it again due to a typo in the cut sites and the number of sequences we desired for each backbone. Luckily, we caught these errors, and after checking the program once again, we ran it a final time this afternoon.
  • It took about 45 minutes for the program to generate and reverse translate the 54900 sequences.
  • During this time, we created a function that will re-translate the sequences that the generator output. It compares the original helix with the re-translated helix to make sure that our reverse-translate works properly.
    • This step went smoothly, and we verified that the sequences were reverse-translated properly.
  • To make sure that the distributions generated were as expected, we made WebLogos of the helices generated(see below).
• The output file (in the Dropbox: iGem > chip > final chip.csv) originally had the following headers: 'Target', 'Backbone #', 'Helix Sequence', 'Backbone Sequence', 'Nucleotide Sequence of Zinc Finger'
  • We wanted to convert this information into FASTA format.
    • We wrote a function that converted our original file into fasta format (in the Dropbox: iGem > chip > fasta.csv)
    • The file FASTA_total (also linked above) contains the FASTA for all 50000 sequences (including the 100 controls).
    • For those curious, the FASTA format just a format that looks like this:

>Header (For us the header is: Target, Backbone #, Helix Sequence, Backbone Sequence)(The header for the controls are: Index Number, 'control')
 Sequence (In our case, the nucleotide sequence of the zinc fingers)

Generated WebLogos for Final Chip

AAA	ACC	CTC
CTG	GAC	TGG

• FASTA-Formatted Chip Data:

>NNN(Target Triplet) BB# Helix Seq.

Nucleotide seq. of ZF

Bioinformatics Candids

zif268 sequence by memory. You know you've stared at too many zif268 sequences when...

File:HARVPrimer Index iGEM 2011.xls

Design of Plate Practice Sequences

While we wait for the chip to come in, we have a number of techniques and protocols that we can practice on beforehand, so that when the chip comes we'll be ready to go to use what they give us. We will be practicing the following techniques:

• Cutting ZF1 out of our oligos
• Inserting ZF1 into the expression plasmid in between the omega subunit and the linker before F2
• Verifying that combination of our F1 from the oligo with the plasmid produces a viable, functional ZF
• Amplifying subpools of oligos for testing
• Inserting the expression plasmids into the E. coli containing our selection genome
• Verifying that our ZF-binding site/GFP expression paradigm works

To this end, we will be ordering a 96-well plate from IDT containing oligos that will simulate the entire tube of oligos that we will receive from Agilent in four weeks. These oligos will consist of the following:

• 6 positive controls (we know which DNA sequences these bind to)
  • 3 of them being the F1 fingers of Zif268, OZ052, and OZ123
  • 3 of them being ZF F1s derived from CODA.
• 90 generated sequences, picked from a subset of the chip
  • These are picked evenly across the 9,150 sequences generated on the cihp for the TGG triplet F1 target from the colorblindness "bottom finger" target, GTG GGA TGG. This particular target was chosen because the F2/F1 is a GNNTNN combo, which might be more likely to get hits from our chip generation sequences.

The primer tag sequences for the 90 generated sequence subset will be the same as they are on the chip (for the sake of explanation, we will refer to them now as P1F and P1R in this paragraph). The positive controls will be flanked immediately by the same primers as the generated subset so that we can amplify everything as one pool altogether should we need to (so this will be P1F and P1R). However, we will also put an additional set of primers outside of the P1F/P1R primers for the positive controls so that we can specifically amplify the positive control subpool, should we want to. These primers will be the same as the primers for the positive control on the chip (which will be called P2F and P2R here).

To recap, on the chip we will have the following oligos :

45750 other oligos for the 5 other target sequences
Oligos (TGG set, 9150 total):   | P1F | type II binding site | generated F1 | type II binding site | P1R |
Oligos (+ control, 100 total):  | P2F | type II binding site |  control F1  | type II binding site | P2R |

In our test pool of 96 sequences, we will have two types of oligos (note the two pairs of primers around the positive controls):

Oligo (TGG set, 90 total):          | P1F | type II binding site | generated F1 | type II binding site | P1R |
Oligo (+ control, 6 total):   | P2F | P1F | type II binding site | generated F1 | type II binding site | P1R | P2R |

Once we get our test sequences back from IDT, they will come in a 96-well plate with one oligo in each plate. We should make a mixture using some of each well in order to create a tube that contains all 96 sequences. This will simulate the tube that we will receive from Agilent, except instead of 55,000 sequences we will have 96 sequences only in this tube. From here, we can practice using this as a library.

We can pretend that this tube is just 96 generated sequences on the chip, treating the positive controls as if they were also generated sequences (we only include them in the 96 to ensure that we will indeed get a "hit" from this practice screening). Thus, we can just use the P1F/P1R primer set to amplify all of them in order to use them for the subsequent steps.

These subsequent steps will be those that were outlined above, namely cutting out the F1 sequence from each oligo, ligating this F1 into our expression plasmid, putting the expression plasmid into our selection strain, observing colonies which get infused with ZFs that bind to our target site (the "hits"), and sequencing the colonies that get hits to determine which ZF they are expressing.

We will be repeating these exact same steps once we get the chip, so if we can perfect our protocols with these practice sequences, we should be golden when the chip comes in.

June 29th

Our first day with everyone in the wet lab!

PyrF and rpoZ sequencing:

• For some reason, Genewiz said that sequencing failed due to "no priming." We will redo the PCR and send the products in again today.

Lambda red recombination and MAGE:

• The cultures made from the kan plates from our earlier attempt at lambda red did (in some cases) grow, including one colony in kan from 3.75µL arabinose, 100µL plated.
  • PCR of liquid culture: used 1µL of culture diluted 1:20 as well as saturated culture of ∆hisB∆pyrF∆rpoZ+pKD46 (diluted 1:20) as a 1529620 locus wild-type control
    • primers (from Vatsan): 1529481-f, 1529806-r
  • KAPA mastermix and procedure with 56˚C annealing and 90 seconds elongation
  • E Gel of product: both wild-type and the sample hopefully containing the insert had the same short band of around 350bp--the recombination was unsuccessful

• Used overnight saturated culture to reinoculate; once close to mid-log, culture split into 2 1.5mL amounts and 37.5µL arabinose added to each
• same procedure as previously described, but with about 300ng kan-ZFB construct and a 2.5µM final concentration of HisBNuke3 (12.5µL of 10µM stock)
  • electroporate with 1.8 kV, about 5
  • recover 3 hrs
  • kan-ZFB insertion colonies plated on kan, MAGE on amp

PCR Preparation

• Lambda Red- Selection strain glycerol stock: 1/100 dilution, 2 uL stock with 198 uL ddH₂O
• Spec (Colony)- Touch 1 colony with pipet tip, add and mix with pipet in 20 uL ddH₂O, then vortex

PCRs

1. PKD46 (Lambda Red)

• Kapa Mix 2x- 12.5 uL
• Primer_F- 0.75 uL
• Primer_R- 0.75 uL
• Template 1 uL
• ddH₂O- 10 uL
• (25 uL total)

1. Spec (Colony)

• Kapa Mix 2x- 12.5 uL
• Primer_F- 0.75 uL
• Primer_R- 0.75 uL
• Template 1 uL
• ddH₂O- 10 uL
• (25 uL total)

1. Spec (Miniprep)

• Kapa Mix 2x- 12.5 uL
• Primer_F- 0.75 uL
• Primer_R- 0.75 uL
• Template 2 uL
• ddH₂O- 9 uL
• (25 uL total)

Expression Plasmid Design in silico

Today, we designed our expression plasmids in SeqBuilder. This included plasmids for our 6 target sequences, and 3 positive controls (9 in total). These positive controls were the following:

Index	Nucleotide Sequence (5\'-3\')	Helices (F3 to F1)	Notes
16	GAA GGG AAC	QDGNLGR RREHLVR HRTNLIA	Very similar to one of our target sequences (CB top), which is GAA GGG ACC
55	GGA GTG GTG	QTTHLSR DHSSLKR RNFILQR	Very similar to a target sequence (FH top), which is GGA GTG CTG
77	TGT GAA TAG	RRRNLQI QQTNLTR QPHGLTA	Out of ze air

Each of our expression plasmids contained:

• Omega subunit
• Omega/F1 linker (taken from paper that Dan and Noah emailed us), http://nar.oxfordjournals.org/content/36/8/2547.short
• type II binding sites
• gap between type II binding sites that contains XbaI restriction enzyme site (which is not present anywhere else in the entire expression plasmid)
• F1/F2 TGEKP linker
• F2 for a specific target sequence
• F2/F3 TGEKP linker
• F3 for a specific target sequence
• TAA stop codon immediately after F3

All of this is on our spec-resistance-containing plasmid. The above construct replaced the GFP which was present previously on this plasmid.

Tomorrow we will begin design of our primers from these SeqBuilder files.

June 30th

Lambda Red, Backbone, and Sequencing PCR

• Gel run on the presence of a Lambda Red protein in the pKD46 plasmid showed that it is indeed present, so our recombination failures have not been due to an incorrect plasmid.
• Gel run on the backbone of pZE21G plasmid was success and took us one step closer to obtaining all parts necessary for the three part assembly
• Gel run on the pyrF and rpoZ was success
  • Therefore we sent the PCR products and primers to GENEWIZ for sequencing again

pZE21G backbone:

• Since last night's PCR was successful, we will redo it with a few protocol adaptations to get a cleaner product and to increase our yield when we purify
• KAPA mastermix and protocol: primers HindIII-F and KpnI-R
  • template: pZE21G miniprepped plasmid, 1µL
  • 2 min elongation time, 30 cycles
  • 2 samples at 55˚C annealing, 2 samples at 60˚C

Lambda red and MAGE:

• Yesterday's prep produced tiny colonies on the MAGE plates and (so far) none on the kan-ZFB plates. Just in case it didn't work, we will redo the lambda red using even more DNA and perform a second round of MAGE using culture from yesterday that was not plated.
• same procedure, but with the following changes:
  • 5µL kan-ZFB (about 1 mg)
  • recover 3 hrs
  • kan-ZFB: plate 100µL and 2 mL on kan plates
  • MAGE: plate 1µL and 10µL on amp plates
• To see if the colonies on the MAGE plate knocked out HisB, we chose 24 colonies, resuspended them in water, and put half the cells in LB (complete media) and half in NM media (does not have histidine). 96 well plate, 150µL media, grown overnight at 30˚C.

ZF Expression Plasmid Ultramer and Primer Design

Today, we designed primers ZF_073 through ZF_085 as listed in the iGEM Primer Index spreadsheet. These were basically two sets of primers: the primers to clone out the omega subunit and linker, and the ultramers that would construct the last part of the linker along with the type II binding sites and F2/F3 fingers. One should refer to the primer list for the sequences.

Note: the annealing sequence for the ultramer overlap contained a 72 degree melting temp hairpin. To get around this, I changed one of the codons in the F2 backbone. The F2 backbone begins with "FQCRIC", and so I changed the codon for the arginine (R) from CGC to CGT, which resolved the hairpin problem.

June 30th - Bioinformatics

Updated Primer list and FASTA formatting

We ran into a small hiccup, when we were informed that we had forgotten to reverse translate the reverse primer sequences that were being appended to the generated sequence. This is because the primer sequences we were given were the sequences for the actual primers, rather than sequences to which the primers would bind. Luckily, we caught this error! We did have the re-run the generator because we had to make sure that our generated sequences did not contain the new primers.

• Here is the updated primer list:

This is the set of final target sequences with assigned forward and reverse primers (tags for PCR):

Disease	Target Sequence	Forward Primer (5'-3' NOT REVERSE COMPLEMENT)	Reverse Primer (5'-3' REVERSE COMPLEMENT)
Colorblindness	GCT GGC TGG	ATATAGATGCCGTCCTAGCG	TGGGCACAGGAAAGATACTT
Colorblindness	GCG GTA ACC	CCCTTTAATCAGATGCGTCG	GGTCGCCCTTATTACTACCA
Familial Hypercholesterolemia	GGC TGA GAC	TTGGTCATGTGCTTTTCGTT	TCTGAGTATCCGATACCCCT
Familial Hypercholesterolemia	GGA GTC CTG	GGGTGGGTAAATGGTAATGC	GCTATATCCGGGGAATCGAT
Myc-gene Cancer	GGC TGA CTC	TCCGACGGGGAGTATATACT	TTGGCCTGAAGCAGTTAGTA
Myc-gene Cancer	GGC TGG AAA	CATGTTTAGGAACGCTACCG	GGGAGGGAACGGAGATTATT
Controls	n/a	GTACATGAAACGATGGACGG	CGCTGAGGAGACTATACCAG

There was also a small error in the FASTA formatting. There are not supposed to be any spaces in the header, so the spaces were replaced with underscores.

• Example:

>1_control

GTACATGAAACGATGGACGGGGTCTCAGCCATTCCAATGTCGTATCTGTATGCGTAATTTTTCACGCAAACACCATTTGGGTCGTCATATCCGTACGCACACGGTGAGACCCGCTGAGGAGACTATACCAG

July 1st

HisBNuke3 MAGE results:

• All the MAGE round 1 colonies grew overnight in the LB but not the NM medium: either they all had the HisB gene knocked out (unlikely) or there is something wrong with the NM medium. As a control we grew (∆HisB)∆pyrF∆rpoZ+pKD46 in NM, but nothing grew, implying that the problem is with the NM medium.
• There were small colonies on the MAGE round 2 amp plates, so we chose 12 from each plate and grew them in 100µL of SOC medium.
• PCR of the colonies for sequencing:
  • KAPA mastermix and protocols, with His3_F and His3_internalR primers, 2µL culture as template, 65˚C annealing, 15 sec elongation, 25 cycles
  • ran on gel: band around 500-600, but very faint (probably because we did not let the culture grow up enough)
  • sent to Genewiz to be sequenced with His3_F primer

Lambda Red recombination results:

• The plates from 6/30 had an almost crystalline formation on them, which may or may not be bacteria. The 6/29 plates, which we had left at 30˚C, did have colonies but they may be contaminants. We grew up 12 colonies from each 6/29 plate and 6 "colonies" from the 2mL 6/30 plate in SOC medium with kanamycin, and next week we will PCR the 1529620 locus to check.

pZE21G spec backbone:

• PCR of backbone was successful (see E gel below). Gel extracted with Qiagen kit with the following modifications to the kit instructions:
  • 2 gel volumes of buffer QG, heated 10-15 min
  • after heating added 10µL 3M NaOAc
  • eluted in 30µL ddH2O
  • 157.4ng/µL 260/280=1.9; 129.2ng/µL 260/280=1.88

Selection system plates:

• Made 3-AT and 5-FOA plates following 2006 Meng Nature Protocol (see protocols for details). 5-FOA plates have a blue stripe, 3-AT plates (0.5 mL 3-AT) have a green stripe.

July 4th

FIREWORKS

July 5th

Team ZF Assembly

• Assemble and confirm zif268 plasmid
  • Lac-ω-zif268 with spec → Lac-zif-ω with cpic
  • ZF: 2-3 ultramers
  • PCR out ω subunit

Team Wolfe Selection

Goals for the week:

• MAGE out HisB
  • What we've been trying/why it's not working — keep trying!
• PCR out Kan Cassette (colony PCR)- analysis/check that it worked
  • We did the insertion and have things growing in Kan that look like our cells — we probably have it!
  • As long as it's the right size and in the right place, it probably worked, meaning we have 2 HIS genes → MAGE is to remove the endogenous genome copy in vivo
  • Construct (PSR01): ~ - KAN - ZFbs - weak promoter - URA3 - HIS3- ~
• Fix/Test NM media
  • Made last week, nothing worked in it — try more glucose
  • Wolfe strain seems to grow really slowly (~36h); try glycerol stock of PKD46, grows faster
• Make other 3-AT plates (1.5)
  • 3-AT is a competitive inhibitor of His; the stronger His is expressed, the more 3-AT the cell can tolerate and still grow
• Test 3-AT plates

Today's results:

• PCR to check whether kan-ZFB-wp-hisura was successfully inserted into the genome
  • Used KAPA master mix and protocols, same procedure as 6/29/11
  • Because of KAPA shortage, only ran samples 6-8 from 100µL 6/29 plate and 6-7 from 2mL 6/29 plate plus (ΔHisB)ΔpyrFΔrpoZ+pKD46 from 6/29 culture as a control (should produce a band around 300bp, while the insert would make the band 2-3kb)
  • Ran on E-Gel with team TolC's samples, but there was an issue loading the gel, so also ran separately on another gel. Unfortunately most of the PCR reactions strangely did not work, but two of the samples appeared not to have the insert (see below).

• Redo PCR:
  • out of KAPA so had to use Invitrogen Platinum Supermix
  • each reaction had 22.5µL supermix, 0.5 µL each 10µM primer, 1µL template, 0.5µL H2O
  • 20 reactions, including one from the same control used above.
  • followed Invitrogen instructions, with 3 min elongation, 56 C annealing, 30 cycles
• Assuming the PCR is unsuccessful, we will grow up (ΔHisB)ΔpyrFΔrpoZ+pKD46 (from 6/28 plate) overnight in LB+amp
• NM medium:
  • To test Sarah's NM (made 6/30) we will grow up pKD46 strain in 3mL of it overnight at 30 C. If no bacteria grew, we will try remaking it ourselves.

Team TolC

• PCR out and insert Kan construct in front of TolC (similar to Wolfe selection)
  • Construct 1: ~ - KAN - ZFbs - weak promoter - ~ (done, PCR, gel extraction)
    • Used primers ZFB-wp-tolC-r and tolC-kan-f
  • Construct 2: ~ TolC ~ (do not have primers yet)
  • Note that ~ indicates a homology region
• Need the EcNR2 strain to come in before we can work with it (came in Thursday 7/7/2011, the one from Wednesday 7/6/2011 was not growing well.)
• Inactivate rpoZ (similar to inactivating His3, but should be easier to use MAGE with- EcNR2 is a strain designed for MAGE)
  • MAGE oligo rpoZ deletion will arrive on Thursday 7/7/2011
• Make SDS (how we test TolC +vely)(done, stored at room temperature)
  • Only cells with active TolC can survive SDS treatment

Web Design

To Do

• Safety Description
  • Email Alain/Harvard biosafety group ✔ (Meeting pending)
  • Needed information:
    • Strain names
    • Antibiotic Resistance
    • DNA inserts/removals
• Draft Project Description ✔
  • Finalize
• Update the Facebook page/create a new 2011 page
• Get the Public Wiki up and running
  • Figure out templates
• Update Twitter

Notes to All Teams

• Teams: Make sure everything is organized in your dropbox!
• *Announcing a New (and Final) Plasmid Name* PSR01: formerly known as Wolfe Plasmid/Vatsan's Plasmid/Selection
  • Contains ~ - KAN - ZFbs - weak promoter - URA3 - HIS3- ~

July 6th

Team ZF Assembly

Because our primers still haven't arrived, the members of Team ZF Assembly are working with the Web Design Team.

Team Wolfe Selection

• Redo PCR Results:
  • Samples 1,3,4,5,6,7,8,9,11 from the 100µL 6/29 plate all showed unsuccessful introduction of kan-ZFB-wp-hisura
  • Samples 2,3,4,6,7,8,9,10,11,12 from the 2mL 6/29 plate all showed unsuccessful introduction of kan-ZFB-wp-hisura
  • (ΔHisB)ΔpyrFΔrpoZ+pKD46 from 6/29 culture used as a control

• NM media has 1% of the glucose concentration written in the protocol, it is 0.4mg/ml instead of 40mg/ml. Nevertheless, our overnight culture of pKD46 grew successfully so we will continue to use the media unless other problems arise.
• One possible explanation for our failure to PCR out a kan-ZFB insert from the recombined colonies is that the insert was integrated into the genome somewhere else besides the 1529620 locus. This might be why the PCR shows no insert while the colony still grows in kanamycin. We will try to PCR the insert using primers that anneal to the kan and his-ura sections (since these primers are about 70 bases long, we will do a 2-step cycle)
  • Invitrogen Platinum Supermix reagents and protocols, with 3:30 at 72˚C instead of separate annealing and elongation, 25 cycles
  • used same cultures as for PCR listed above
  • kan-ZFB-wp-hisura insert as control
  • results from 2 E Gels: PCR not very successful. Colonies showed no bands while the control showed only a side product too small to be the full insert.

• Grew up 24 more kan-ZFB lambda red recombined colonies (12 from 100µL 6/29 plate, 12 from 2mL 6/29 plate) in LB+kan in 96 well plate for PCR tomorrow
• Diluted 24 colonies (1 ss+pKD46 control, 11 from MAGE round 2 1µL plate, 12 from MAGE round 2 10µL plate) in 30µL ddH2O and split between NM,NN+Histidine, and LB+amp to check his phenotype
  • NM+his media: 49mL NM, 1 mL 5% histidine solution
• Made 1.5mL 3-AT plates

Team TolC

• Gel extraction of KAN-ZFBs-wp as there is a side product.
  • To increase yield, spin down the contents of both eppendorf tubes into a single column, have a 2:1 volume ratio of QG Buffer to gel volume, e.g. 1ml QG buffer to 0.5ml gel in step 2, and elute in 30µl water in step 13)
• checked the ECNR2 strains, both appear to have not grown
  • note from 7/7/2011, new ECNR2
• running another PCR since there was errors in gel extraction, and the yield was less than 20ng/µl, and purity was very bad.

TOLCINV PCR-Machine 7

• 94°C for 2 min
  • 94°C for 30 s
  • 53°C for 30 s
  • 72°C for 1.5 min
    • Previous three steps repeat 30 times
  • 72°C for 5 min
  • 4°C forever

Web Design

• Project description
• Web design brainstorming;exploring past designs and templates

July 7th

Team ZF Assembly

Our primers still haven't arrived. We are working with the Web Design Team.

Team Wolfe Selection

• PCR for Round 2 MAGE cultures in LB media
  • The samples came from the overnight culture of MAGE/control strains grown in LB+amp, NM+his, and NM. Oddly, the (∆HisB)∆pyrF∆rpoZ+pKD46 control grew only in NM+His and LB, and not in plain NM.
  • Samples
    • Control= 1 ss+pKD46
    • 11 cultures from 1μL plate in LB media
    • 12 cultures from 10μL plate in LB media
  • Program
    • Anneal at 56°
    • Elongation for 90 seconds
    • All else according to standard KAPA protocol
  • E gel of control and 1µL plate colonies 1-8 to check PCR worked (it was successful)
  • samples prepared for sequencing tomorrow

• Kan-ZFB insert check PCR results:
  • the overnight cultures grown yesterday were used in a PCR (same KAPA protocol as before) around the 1529620 locus. Not all the cultures grew; 100µL plate cultures 1-5 and 2mL plate cultures 1-12 were used.
  • Results: some of the reactions, strangely, did not work, but the ones that did showed a short band and thus did not have the insert (see below)

• HisBNuke3 MAGE round 3:
  • used same protocol as previously described, using 1.5mL mid-log culture from MAGE round 2
  • will recover overnight so that we can reinoculate and continue MAGE rounds tomorrow

• NM medium:
  • added 3.9g glucose to 100mL NM medium to bring the glucose concentration up to the correct level.
  • Because (∆HisB)∆pyrF∆rpoZ+pKD46 did not grow in plain NM, we are curious to see if that was due to low glucose levels. One colony from a plate was put in 3mL NM(gluc) and will be grown overnight.

• HisB MAGE2:
  • In case the sequencing does not show successful MAGE, we will grow overnight 48 more colonies (24 from each plate) in 100µL of NM(gluc) and LB+amp

Team TolC

• making culture tubes of ECNR2 and ECNR2delTolC for glycerol stock (no Amp)
• making culture tubes of ECNR2 for MAGE to delete rpoZ (one with amp, one without)
• dilutions of rpoZ deletion MAGE oligo, 20µM
• dilution of rpoZ deletion MAGE oligo, 1µM, for MAGE.
• serial dilution of ECNR2 after MAGE round 1, and round 2, with 20µl of 100x dilution of concentrated culture. For plating onto amp plates.
• During Gel extraction, ignored 3x volume in step 2 and instead used 500 µl of QG buffer. Additionally, used 18 µl of EB buffer and not water in step 13

Web Design

Brainstorming

• Minimalist toolbar, metallic crimson color
• "Popout" menu below, not dropdown
• Slideshow on front page
  • First slide: Brief text project description, brief youtube video description (in layman's terms)

July 8th

Team ZF Assembly

PCR of omega+zif268 with overhangs

We performed a PCR to take out our omega subunit plus zif268. We used the following recipe:

• 10 ul KAPA readymix
• 0.75 ul of hindIII (primer)
• 0.75 ul of wF+plLacO (primer)
• 1.2 ul template
• 12.3 ul water

The first steps of the PCR involved heating at 95* (for 5 minutes) and 98* (for 20 seconds). Annealing temperature was 56*. Extension time was 30 seconds.

The product of the PCR should be 709 bps. It includes the omega subunit, zif268, as well as overlap sequences homologous to the selection plasmid. We ran an e-gel to ensure that our desired product was present:

Gel purification of PCR product

We had to gel purify our PCR product in preparation for isothermal assembly, using our protocol for gel purification. The result from running the gel can be seen below - we cut out the bands at 709 bp, the expected size of our product.

In the final step of the purification process, we eluted our DNA in buffer EB. We used the nanodrop spectophotometer to determine the concentration of DNA present.

• The concentration was 54.3 ng/ul.

Team Wolfe Selection

MAGE round 3:

• MAGE cultures that recovered overnight were saturated, so we made 1:1000, 1:10000, and 1:100000 dilutions and plated 20µL of each onto amp plates and left at 30˚C overnight.

MAGE round 2 cultures from yesterday:

• We did a PCR (His_F and and His_R primers) on 24 of the 48 cultures we grew and sent them off for sequencing.

Results of NM culture:

• The selection strain (∆HisB∆pyrF∆rpoZ+pKD46) did not grow in NM, which is worrisome. None of the MAGE samples grew in NM either, so either they all have HisB knocked out or there is something wrong already with the strain's His pathway.
• We will grow up selection strain (without pKD46) from glycerol stock in LB+tet and transform with Vatsan's plasmid tomorrow to see if that has any effect on the his-deficiency phenotype.

Kan-ZFB insertion: modified nucleotides:

• Primers finally arrived that would put modified nucleotides on the 5' ends of the insert, which should improve lambda red efficiency.
• PCR: KAPA protocol with Kan forward phosphorthioate and URA2 reverse phosphorthioate, 56˚C annealing, 90 sec elongation, 25 cycles, 1µL kan-ZFB-hisura DNA as template
• Results: PCR only produced a smaller side product. This is strange since we also ran a gel of all our different kan-ZFB-hisura purifications and they all run at the correct size (see images below).

Team TolC

• Performed re-inoculation of ECNR2-Placed into tube labeled ECNR 2 MAGE 3 in 30 degree shaker.
• grew up 24 colonies total for sequencing ECNR2 for rpoZ deletion (the colonies appear to have grown much faster than expected).
  • rows A (MAGE round 1) and B (MAGE round 2), for PCR and sequencing. to be placed in the 4C refrigerator after use as template.
• RPOZ PCR-Machine 6
  • Primer Annealing = 56 degrees
  • Extension 48 = seconds

Team Web Design

• Edited/Re-drafted our project description, see Dropbox (It's a bit long as is now, but the excess informaiton that we cut out can still probably be used somewhere on our website
• Sketched draft pages of the public wiki
  • Homepage- first draft sketch done based on the characteristics and requirements we'd discussed. However, there are a few issues (i.e., how to include some of the iGEM wiki reuqirements).

July 9

Team ZF

Isothermal Assembly

We performed an isothermal assembly in order to insert omega+zif268 into the plasmid containing the spec backbone.

• The concentration of the plasmid (previously prepared) was 157.4 ng/ul.
• The concentration of the w+zif268 was 54.3 ng/ul.

Using our isothermal assembly protocol we determined we needed:

• 0.63 ul backbone (length: ~2.2 kb)
• 0.59 ul w+zif268 (length: ~0.7 kb)
• 2.78 ul water
• 15.0 ul isothermal assembly solution

Transformation of electro-competent E. coli

We electroporated our cells so they would take up the plasmids, using:

• 1.0 ul DNA
• 40.0 ul cells
• 500 ul LB

We plated the cells, using this protocol, on spec plates, one of which contained 50 ul of cells and the other 150 ul of cells. The cells have been incubated at 37*, and will be left there overnight. Cells that have taken up the plasmid have spec-resistance and should be able to survive. Tomorrow, we will be picking colonies and performing PCR on them to determine whether they contain w+zif268.

Team Wolfe

• MAGE3 plates look good--we'll choose colonies for sequencing on Monday.
• Transformation of selection strain with Vatsan's plasmid:
  • We're curious to see whether Vatsan's plasmid (Zif268 omega, ZFB, wp, hisura) will have an effect on the (∆HisB)∆pyrF∆rpoZ strain's growth despite the seemingly intact HisB.
  • Transformed mid-log selection strain (reinoculated from overnight culture) with about 100ng of Vatsan's plasmid following standard procedure.
  • After 2 hr recovery plated on amp plates with 100µL or 1mL

July 10th

Team ZF

PCR to check for omega+zif268

All colonies that grew on the plates we left overnight should have spec-resistance, but they may not have the omega and zif268 unit that we inserted yesterday with isothermal assembly. We performed a PCR on 13 colonies picked from the 50 ul plate to find a colony that contains the w+zif268 insertion. We used the same recipe at our PCR reaction [[#PCR of omega+zif268 with overhangs on Friday. If the insert is present, then we should see a band at 709 bp. We also included 2 positive controls: our isothermal assembly product and our selection strain from which the w+zif268 was originally copied.

We ran an agarose gel to check the bands:

Lanes 1-8

Lanes 9-16

None of the colonies displayed any bands, except for primer residues. Lane 16 contained the selection plasmid, on which we performed a successful PCR on Friday, so we definitely expected a band at 709 bp. Because the positive controls did not have a band at 709 bp, we suspect that something went wrong with the PCR. We plan on re-running the PCR tomorrow.

July 11th

Team ZF

We did a miniprep of the 12 colonies we picked Sunday and left overnight in LB. Here are the concentrations of our products:

ID	Conc. (ng/ul)	260/280
1	6.63	1.27
2	12.96	1.53
3	9.28	1.41
4	7.23	1.31
5	12.64	1.55
6	10.77	1.48
7	17.19	1.73
8	39.70	1.78
9	55.73	1.81
10	24.34	1.72
11	25.19	1.68
12	38.57	1.74
13	27.26	1.75

Then we performed a PCR on the 12 miniprep products, the 12 colonies in LB, as well as 3 controls (negative control, isothermal assembly product, selection strain) to find a colony that has the omega+zif26 insertion:

• 10 ul KAPA readymix
• 0.75 ul of hindIII (primer)
• 0.75 ul of wF+plLacO (primer)
• 1.2 ul template
• 12.3 ul water

The first steps of the PCR involved heating at 95* (for 5 minutes) and 98* (for 20 seconds). Annealing temperature was 56*. Extension time was 30 seconds.

We ran a 1% 100 ml. agarose gel at 120V to check the success of the PCR.

Gel of our colonies, miniprep-ed colonies, and controls to check for w+zif268 insertion

The bands were rather thick, so it was difficult to estimate the exact band size. However, the bands appeared a bit below 650 bp, although we expected a size of 709 bp, so we ran an e-gel on some of the colonies to ensure that that bands were indeed the right size.

Gel to ensure our bands were the correct size (709 bp)

The bands were closer to the size that we expected, so we decided that we successfully inserted w+zif268 into the plasmid. We decided to pick colony 9 (which had the highest concentration post-miniprep) and work with that from now on. We made spec plates with 50 ul of colony 9.

Team Wolfe

Selection strain transformed with pSR01:

• both plates had lots of colonies--almost too many. We need to make sure the plasmid is, indeed, in these cells.
• Colony PCR:
  • picked 6 colonies and diluted in 7µL H2O: 3 for PCR template and 4 to be grown up in LB+amp
  • KAPA protocol using M13_F and M13_R primers (anneal to the vector), 50˚C annealing, 2min elongation
  • E gel results: lots of bands but rather messy and not exactly what we'd expect. We'll try to verify the presence of the plasmid in a few other ways.

• Sequencing:
  • We sent out the PCR samples with M13_R to Genewiz
• Culture PCR:
  • We used the cultures made with the colonies used for PCR above as template to see if this gives us cleaner results.
  • same protocol as above except with 1µL of 1:20 dilution of culture as template.
• Assuming that the plasmid is indeed in the colonies, we will grow an overnight culture in LB+amp as well as the Wolfe selection strain and tomorrow we will use a growth reader to check their phenotypes in NM

MAGE round 3 colonies:

• In case pSR01 does not rescue the selection strain's growth phenotype, we will PCR 96 colonies from the MAGE3 plates and send them out for sequencing tomorrow.
  • Used 9µL KAPA, His_F and His_R primers, 3µL suspended colony (out of 7--the remaining 4 grown in LB+amp)

Thio kanZFB:

• We retried the PCR to put modified nucleotides on the ends of the kan-ZFB-wp-hisura insert using the same procedure as 7/8/11
  • E gel: reactions didn't work

• Tried again with a longer elongation time (3 min) and let run overnight.

Team TolC

Sequencing of rpoZ delete

• Since the sequencing was sent after 3pm on Friday, it wasn't picked up before today (Monday), so we are going ahead with lambda red recombineering of the KAN-ZFB-wp into the ECNR2 genome
• glycerol stocks of ECNR2 and ECNR2ΔTolC were made.

Team Web

• Looked at good wikis from last year.

July 12th

Team ZF

PCRs of finger ultramers

We received the ultramers for fingers two and three of our 6 experimental expression plasmids. We performed an overlap PCR in order to join the two ultramer pieces and make a whole unit. Ultimately this unit with be assembled with the omega subunit and the spec backbone to make our final expression plasmids. We used the following recipe:

• 10 ul KAPA
• 13.5 ul water
• 0.75 ul forward ultramer
• 0.75 ul reverse ultramer

We had an annealing temperature of 58* and an extension time of 15 seconds.

Gel of our product from the ultramer PCR. Note that the first lane's PCR was done in a single tube, while all the others were done in a strip.

However, in addition to the expected band at approximately 300 bp, the bands for our ultramers was extremely streaky, indicating that there may be other contaminants. We decided to perform a PCR purification of these samples, using our protocols, and see if there was an improvement in the gel.

Gel of our product after PCR purification

Even after the gel purification, our bands were streaky. We decided to redo the PCR, placing all the reactions in single tubes, performing a touchdown PCR instead. Our annealing temperature started at 70*, repeated for 2 cycles, and then decreased 2*, every two cycles, until it reached 58* (the optimal annealing temperature), where it remained until the 25 cycles were complete. We left this PCR going overnight. (See July 13th for the gel image.)

PCR of expression plasmid cross-junction

We also performed a second PCR on colony nine (the colony we decided with which we decided to proceed) to confirm that our omega+zif268 in the spec backbone was successfully inserted into the E. coli. The expected product was the cross-junction on the plasmid, approximately 1.4 kb. We used the same recipe as that used on July 9th, except with a forward primer of PZE23G-3581 F and a reverse primer of PZE23G-2133 R, and had a 55* annealing temperature and an extension time of 45 seconds.

After running an e-gel, we confirmed that our w+zif268 was inserted into the plasmid.

Lane 3: Gel of our PCR to check for the cross-junction in colony 9.

PCR and gel extraction of omega subunit

We performed a PCR to get out the omega subunit+linker, with an annealing temperature of 56* and an extension time of 15 seconds. The miniprep from colony 8 was the template DNA. We will use the product in assembling our final expression plasmids.

We determined that the PCR was successful after running the sample on an agarose gel, and performed a gel extraction so that we could use the product in our isothermal assembly.

Lanes 1 and 2: Gel of our PCR to get omega subunit.

The gel extraction was successful, and we had a final concentration of 120.5 ng/ul.

Overlap PCR of OZ052 and OZ123

We performed an overlap PCR using the ultramer pairs that solely encoded the F1, F2, and F3 fingers of OZ052 and OZ123. The annealing temperature was 62* and the extension time was 15 seconds. The results of the PCR can be found below (the products are only in the last two lanes) and the products were also PCR purified before being put into storage at -20*C.

Last two lanes: OZ052 and OZ123 products, respectively

Team Wolfe

MAGE round 3 samples:

• 94 sent out for sequencing (numbers go A1-H1, etc.)

Thio kan-ZFB results:

• PCR run out on E Gel: not successful. We do not know what is still causing our PCR to fail.

pSR01-transformed selection strain:

• We discovered that hisB is a two-function protein, with the N-terminal region acting as an HPase and the C-terminal region as an IDPG. His3 only complements the IDPG activity, so even if our MAGE worked, it might destroy our selection system. The two aa deleted in hisB are in the C terminal region, so maybe they do inactivate it. We emailed Keith Joung whose lab made the selection strain to see how HisB was deleted.
  • In case this mutation is correct but lambda red in the selection strain still eludes us, we designed MAGE oligos for use in EcNR2 to either delete the two aa or put 3 stop codons after the HPase region.
• culture PCR results: cultures 3-4 had a strong band (and 2 and 5 weak ones) around 850-1000bp. It is interesting how different these results are from yesterday's colony PCR gel.

• Sequencing results: The sequences sent from Genewiz aligned well with the pSR01 plasmid sequence and covered pretty much all of URA3. This implies that the cells did indeed take up our plasmid.
• Growth phenotype:
  • 12 colonies were chosen and split between NM (gluc), NM+IPTG (to induce zif268 expression), NM+his (gluc), NM+his+IPTG, LB+amp, LB+amp+IPTG and grown overnight. (Final concentration IPTG=500µM)

Team TolC

• MAGE knockout sequencing
  • Received sequencing from the MAGE knockout of rpoZ within the TolC genome
  • Observed all 24 sequenced attempts and it appears as none of them have the knockout and stop codons placed into genome
    • Possible reason behind failure is that one, we may not have been reading the results correctly or two, the MAGE oligo had all three stop codons right next to each other in the oligo and may have needed to be separated by three nucleotides each in order to maximal annealing
• Lambda Red Recombination of kan-ZFB-wp insertion into MAGE knockouts
  • Plates from the recombination showed small colonies
    • With this we picked 6 colonies from the 4 different plated recombination cultures and grew them to saturation
    • Began PCR with TolC_Seq_F and TolC_Seq_R primers in order to determine whether recombination was successful
    • Procedure (on gradient PCR machine, name: ABC, folder: igem)
      • KAPA mixture
      • Then 95 C, 5 min
      • 98˚ C, 20 sec
      • 60˚ C, 15 sec
      • 75˚ C, 45 sec
      • Repeated cycle for 30 times
      • 72˚ C, 5 min
      • 4˚ C, forever
    • Tomorrow we plan to run gel
      • Length will be:
        • 450 bp if insertion failed
        • 1200 bp if insertion of Kan cassette only
        • 1650 bp if insertion of Kan-ZFB-wp
• Insertion Construct for TolC (homology-kan-ZFB-wp-homolgy)
  • Began 90 µL total of PCR for the insertion construct since we ran out
• If gels show failed PCR tomorrow we will start from normal ENR2 without any MAGE and begin with lambda red recombination and possibly make new MAGE primer and then knockout rpoZ

Team Web Design

• Met with Harvard biosafety officer, Sidney
  • Send to him: list of strains, plasmids that we are using
  • Note to all iGEM-ers: We will all be attending a biosafety seminar on Friday, July 15th from 10am to 12n in Biolabs 1058.

In case you haven't already, please see Alain's message below:

Every member of the Harvard iGEM team (unless you are absent on Friday) has to attend the next lab Safey/Biosafety Blood born pathogens training this coming Friday 7/15/2011 from 10 am to 12 noon. The training takes place in the Biological laboratories (16 Divinity Ave) room 1058. If you cannot go and have a very good reason let me (Alain) know. If you attended a similar training session on the Cambridge campus or at the Medical school you don't have to attend. Otherwise you have to go.

July 13th

Team ZF

Results of ultramer touchdown PCR

We ran an e-gel on the product of our touchdown PCR. Once again we have our band at 344 bp. It is still slighly streaky, but much less than our earlier PCR reaction. There are some faint bands smaller than our expected product, which are likely the ultramers we used in the reaction. We'll use the product for our isothermal assembly later today.

Gel of our ultramer touchdown PCR product

Isothermal assembly and transformation of expression plasmids

We followed our protocol for isothermal assembly, using the following recipe:

• 0.63 ul backbone (at 157.4 ng/ul to get 100 ng)
• 0.13 ul omega+linker (at 120.5 ng/ul)
• 0.50 ul ultramer (~30 ng/ul)
• 1.24 ul water
• 7.5 ul isothermal assembly solution

The sizes of the pieces we put together were the following:

• Backbone: 2.2 kb
• omega+linker: 352 bp
• ultramer: 344 bp

Note: We also made a negative control of the isothermal assembly, only putting in the spec backbone without omega+linker or ultramer.

We then performed transformations to insert our isothermal assembly products into E. coli, following our usual protocol. However, we ran out of electrocompetent cells, so only samples 78 - 82 were done with electroporation while 77, 83-85, and the negative control were done with chemical transformation, using these protocols (the samples are named after the reverse ultramer ID in the primer index that were used to generate the ultramer sequences).

We then plated 1 ul of the cells on spec plates and left them overnight at 37*. Because we ran out of our own spec plates, we also had to use LB plates that had spec added to it, and spec plates that were made in April.

Team Wolfe

∆HisB∆pyrF∆rpoZ+pSR01 growth results:

• When no IPTG was present, the bacteria grew in LB+amp, NM+his, and NM, showing that the plasmid rescues the selection stain's growth phenotype! This implies that our strain had the right genotype all along. However, when IPTG was added to the media, the strain only grew well in LB. This is very odd, since IPTG was supposed to induce zif268 and thus His3 expression. We will try a couple things to make sure nothing went wrong:
  • redo cultures in the same pattern as yesterday--perhaps IPTG+/- were mislabeled
  • inoculate cultures of ∆HisB∆pyrF∆rpoZ +/- pSR01 so that Vatsan can use a plate reader to compare their growths
• Joung wrote back and said that the HisB deletion is in fact 6 bases in frame. He also mentioned something about a lac deletion which we are looking into.

MAGE3 sequencing results:

• none of the colonies had the stop codons. This may be because mutS is not knocked out, and it can correct strands that have up to 5 bases mismatched.

Kan-ZFB for lambda red:

• Noah did lambda red in EcNR2 and the plate was covered in crystalline patterns that may be cells. We will test this by:
  • Restreaking some of these "colonies" onto a fresh kan plate to get the bacteria more spread out
  • Streaking a kan plate with pKD46 (from glycerol stock) to see if the kan is effective
  • Taken a streak off the plate, diluted it in 200µL H20, and used 1µL as template for PCR
    • KAPA, 1529620-flanking primers, 90 sec elongation and 56 anneal, 25 cycles
    • Results: 300bp band--the streaks on the plate are bacteria, but they do not have the insert.

• We also retried the thio kan-ZFB PCR using some new primer aliquots. Once again it failed.

• Because this PCR keeps failing, we're going to try a different way and do two separate and shorter PCRs to be joined later in an overlap PCR:
  • PCR of kan cassette: kan cassette as template (diluted 6/16 aliquot), kan F phosphothio and kan R primers, KAPA, 56˚C anneal and 90 sec elongation
  • PCR of ZFB-wp-hisura: ZFB-wp-hisura as template (diluted 6/16 aliquot), ZFB-wp-f and URA3 R phosphothio primers, KAPA, 60˚C anneal and 90 sec elongation

Team TolC

• PCR ECNR2
  • Ran PCR on four colonies from lambda red recombination results, ECNR2 liquid culture from Church lab, and colony from original ECNR2 plate
    • Grew each up in LB Amp liquid culture
    • Tomorrow the gel will tell us whether the insertion was successful and also if the ECNR2 cultures are pure
• PCR Noah's MAGE on rpoZ knockout
  • Picked 15 colonies from each plate with ECNR2 without TolC and ECNR2 with TolC
    • Created liquid cultures of all 30 colonies picked and growing up over night
  • PCR will be ready to send out tomorrow for sequencing
• More kan-ZFB-wp insertion construct needed
  • Ran PCR in order to obtain more kan-ZFB-wp insertion construct from the kan-ZFB-wp-His3-PyrF construct
  • Placed on gel and used gel extraction in order to purify
    • 10.7 ng/

Team Web Design

• Safety, safety, safety!
• Received safety confirmation letter
• Finalized project description
• Updated our iGEM wiki page for the upcoming deadlines (Project description and safety, due July 15th)

July 14th

Team ZF

Results of the expression plasmid transformation

Only samples 78 to 82 had colonies after overnight incubation--these were the same colonies that were electroporated, instead of chemically transformed. Because we only added 1 ul of our cells to the plates, it is possible that this was not enough sample for us to see colonies, especially since chemical transformation is not as efficient as electroporation. The samples on the LB+spec plates had what appeared to be unspecific growth around the edges. This may be because the spec did not diffuse evenly. We will be re-plating all of our samples later today, on new LB+spec plates.

PCR of product from isothermal assembly of expression plasmid

We also ran a PCR on the product of the three-part isothermal assembly (omega+linker, ultramers, spec backbone). We used the cross-junction primers and the same recipe as our PCR on Tuesday. Once again we expected a product of 1.4 kb.

1.2% E-gel of our ultramer isothermal assembly reaction product

There were fairly sharp bands underneath the band we expected. Additionally, the expected 1.4 kb band was not visible for samples 80 and 81, although they were successfully grown on plates. Sample 85 had no bands, not even primers.

Since 80 and 81 grew on our plates yesterday, we continued with our plan of re-plating our original transformations, especially since the chemically transformed cells do have the appropriate isothermal assembly product to insert. We re-plated all the transformations on the LB+spec plates made today, and will leave them overnight in the 37* incubator. We also made cultures from the colonies on plates 78-82 to mini-prep tomorrow.

Rerunning of PCR products (ultramers and isothermal assembly)

In addition, we decided to see if the streaking was possibly caused by the gel instead of a PCR problem, and so we ran three of our products in a 1% agarose gel instead of an E-gel, with the results below.

Products ran in an agarose gel. Note that wells 78-80 on the left side of the gel are empty due to sample mysteriously floating out of the well.

Team Web Design

• Intro video: brief (~1:30) Flash video explaining our project (Our project in 30 sec? 1 min?)
• Interview Joung/Persikov-- videotape (documentary style) for Human Practices page
• Human Practices
  • Broader societal impacts
  • Gene therapy, personalized medicine

Team Wolfe

thio kan and thio ZFB-wp-hisura PCR:

• Ran overnight PCR of kan cassette and ZFB-wp-hisura on E gel: looks great!

• PCR purification with Qiagen kit:
  • added an additional 300µL buffer PB to adjust the pH
  • thio kan cassette: 59.9ng/µL 260/280=1.90
  • thio ZFB-wp-hisura: 100.9ng/µL 260/280=1.89
• Overlap PCR:
  • 4 rxns: two used undiluted template (60ng thio kan cassette and 101ng thio ZFB-wp-hisura), two used template diluted 1:10
  • KAPA, 56˚C anneal, 90 sec elongation, 25 cycles
  • primers (kan f phosphothio and ura3 r phosphothio) added after 10 cycles
  • Results: PCR worked but with tons of side products so we will try to optimize the procedure. Expected product = 3Kb, notable side products = 2Kb, 4Kb. N.B. The samples were accidentally loaded while the gel was running so they are staggered on the gel.

• Gel stab PCR
  • DNA from the 3Kb e-gel band were removed using the stabbing technique and placed in 4 respective reaction tubes (diluted in 20µL water)
  • The 4 samples were separated into template dilutions of 20X, 100X, 200X, and 400X and phosphothio primers for PCR to amplify the desired 3Kb kan-ZFB-wp-hisura sequence. PCR results will be reported tomorrow.
• Template PCR followed by PCR with primers:

1. PCR just the template (1µL diluted thio kan cassette and 1µL diluted thio ZFB-wp-hisura) with no primers, KAPA, 12 cycles, 60˚C anneal, 90 sec elongation
2. take PCR product and use it as template for new PCR either undiluted, diluted 1:4, 1:16, 1:64, 1:256; kan f phosphothio and ura3 r phosphothio primers, 25 cycles, 59˚C anneal, 90 sec elongation

pSR01 phenotype:

• Just to be sure, we will assemble cultures in a flat-bottomed 96 well plate and use a plate reader to track the growth curves.
• 2 colonies ∆HisB∆pyrF∆rpoZ, 10 colonies transformed with pSR01
• media: LB+amp, NM+his, NM, NM+3-AT (1mM), LB+amp+IPTG(100µM), NM+his+IPTG, NM+IPTG, NM+3-AT+IPTG
• plate reader: absorbency of 600nm, measurements every 10 min, shaking 560 sec before each measurement (settings saved in iGEM folder on computer in tissue culture room)

Team TolC

• PCR done of 4 colonies picked from KAN plate (with ECNR2 after recombineering with the KAN-ZFB-wp construct. Running an E-gel showed that the insert was not present. Since the KAN plates were old, it might be speculated that the plates were old, and so, the colonies were not selected for KAN resistance.
  • Primers were TolC_seq_F and TolC_seq_R.
    • Without insertion these two primers will create 449 bp sequence, and with insertion length will be 1650 bp

• • Some of the original culture after recombineering, 1ml solution spun down, and resuspended in 100μl of LB, and plated on new KAN plates. To check, one of the old KAN plates was plated the same way and put in at 2:30pm. (These plates will be checked tomorrow morning.)
• PCR done of a few of the rpoZ MAGE with stop codon insertions. Oligo name: rpoZ_MAGE_KO (Noah's oligo) (Noah's plates, after two cycles of MAGE, on both ECNR2 and ECNR2ΔTolC). The side product in the gel could be due to a low annealing temperature of 53°C, so we should do a gradient PCR (e.g.55-66°C) to get the most product the next time.

July 15th

Team Wolfe

Thio kan-ZFB-wp-hisura optimizing PCR results:

• The gel stab PCR produced a product of the right size, but the 2kb side product was still brighter. The 2-PCR protocol also still had substantial side products but at least they did not completely overshadow the real product. We will accordingly go ahead and do a gel extraction on the 2-PCR samples so that we can try lambda red with them next week.

pSR01 growth phenotype results:

• Unfortunately the computer hooked up to the plate reader spontaneously restarted during the night to download updates, so we lost all the data. Just by looking at the plate, it still seems like IPTG is inhibiting growth. The ∆HisB∆pyrF∆rpoZ controls also did not grow, probably because the plate the colonies were taken from was too old, so we will restreak from the glycerol stock and set up the plate reader again this weekend.

Team ZF

PCR of electro comp expression plasmids

We performed a mini-prep of the cultures that we grew overnight of the electrocompetent cells. We then performed a PCR on the product of the mini-prep, checking for the 1.4 kb cross junction to confirm the presence of our omega+ultramers+spec plasmid. We used the same recipe as the PCR we performed on Tuesday.

Description of gel below.

No bands appeared for PCR peformed on a 1 to 10 dilution of the cultures. Miniprep product from colonies 78, 79, and 82 had the expected band at 1.4 kb, while 80 and 81 had a band that was slightly smaller than the the expected product size. We saw a similar band in our PCR of the isothermal assembly reaction product. We are unsure exactly what is causing this band. If either the omega subunit or ultramers were missing from the plasmid, a similar sized product would result since both are ~350 bp. We are curious if a plasmid can still be formed if one of these components were missing.

We checked the concentrations of our miniprep product to see if that would explain our problem.

ID     Conc. (ng/ul)     260/280     1.4 kb band?
78      16.12             2.10            Y
79      41.64             1.64            Y
80       5.84             2.01            N
81      61.24             1.62            N
82      20.25             1.72            Y

We can't tell whether the concentration of the miniprep product contributed to the strange band we saw. 81 had the highest concentration but still didn't work. We decided to try plating 4 more colonies from 80 and 81, to see if any of them have the appropriate band.

We also decided to make final plates of cultures 78, 79, and 82, using 2 ul of culture and 50 ul of LB+spec. They were plated on new spec plates. We will incubate them at 37* overnight.

Checking the expression plasmid plates

All the plates had colonies on them, although there were still areas of unspecific growth, presumably because of uneven dilution of the spec into the LB plates.

We made cultures of all the chem comp cells (77, 83, 84, 85) and the electro comp cell that did not have the correct insertion (80, 81). We picked 4 colonies from each plate, resulting in a total of 24 cultures. We have left them in the 37* shaker overnight, and tomorrow plan on performing a miniprep and PCR to check for the cross-junction.

PCR to check for omega+ultramers

We performed a PCR on the five electro comp miniprep products, to find out what may be missing. We used the omega_F+pLacO (index: 73) as our forward primer, and each of the respective reverse ultramers as our reverse primers (index: 78-82). We had an annealing temperature of 58* and an extension time of 30 seconds, and the expected product size is 646 bp.

Team ZF results in lanes 8-12

Strangely, we did not get results for sample 78 (FH bottom), even though we got a band there in a PCR earlier today that used the junction primers. We got positive results for samples 79 and 82, and everything else seems to check out with these two samples (bands present in the correct size with junction primers from both isothermal assembly and miniprep templates). However, we are still having problems with samples 80 and 81, which may be a problem with the colonies that we picked. For now, we will assume that the isothermal assembly worked, due to colonies growing on the spec plates for samples 80 and 81, and that we had simply picked bad colonies. We will find out tomorrow if other colonies from the same plate give us the same results.

July 16th

Team ZF

Colony minipreps

Minipreps were performed on all of the samples except for a few where nothing grew in the LB/spec media. These exceptions included 85.3, 85.4, 84.2, 81.2, and 81.3. Possible reasons for no growth for these samples may include: (1) The colony was somehow not a transformed colony and was a cheater (possibly picked from a spot where there was a smaller amount of spec in the unevenly distributed dish), and (2) the colony did not get picked up properly with the pipet tip.

The concentrations of the DNA after miniprep were somewhat low, and a full table of these concentrations and DNA purities can be found below:

Plasmid concentrations

PCR on minipreps to check cross junction

PCR was done on the miniprep products to check for the cross junction length, expected band size of ~1.4 kb. The protocol used was the same as the previous time. In addition to PCR-ing the miniprep products, a positive control was also included, which was the finished Zif268 + omega + spec backbone plasmid (this was the first successful junction PCR we obtained, and so it should work again).

Replating final samples for 78, 79, 82

Strangely, nothing grew on the plates that we seeded yesterday with 2ul of bacteria. We seeded plates again for samples 78, 79, and 82 with 15ul of transformed bacteria instead, and hopefully these should grow by tomorrow.

July 17th

Team ZF

Replating final samples, take 2

We realized that the plates we seeded yesterday (July 16) were seeded from the transformation bacteria tubes, which has a mix of bacteria that may/may not have taken up the plasmid. These plates therefore cannot serve as the final stock plates. We took the E. coli from our initial colony picking and put them in LB + spec to grow to saturation tomorrow, where we will replate again with those bacteria (for which the good PCR results should correlate).

Gel analysis of miniprep junction PCR

The miniprep junction PCR products from yesterday were ran on an agarose gel, with the results below:

PCR Results, expected band at ~1.4 kb

While all the bands are between 1000 and 1650 kb, there are slight variations in the size for which we are unable to account. We will send these out for sequencing, to try to figure out what is going on.

July 18th

Team ZF

Sending expression plasmids out for sequencing

We decided to send out the expression plasmids that had bands at approximately the correct size out for sequencing. We originally wanted to sequence the plasmids, but our miniprep concentrations were not high enough. Apparently, we should be getting high yields from minipreps, but thus far our yields have been around 50 ng/ul at the highest.

We decided to sequence the unpurified PCR products instead. In order to do this we had to re-do the PCRs for Zif268, FH bottom (78), CB top (79), Myc 981 (82). Below are our 1% e-gel results, verifying that we had appropriately sized bands:

Gel of cross junction of Zif268, FH bottom, CB top, Myc 981

Our final samples sent out for sequencing are:

Index     Sample ID             Index     Sample ID
 1         77_1                  11        80_3
 2         77_2                  12        80_4
 3         77_3                  13        -
 4         77_4                  14        83_2
 5         84_1                  15        83_3
 6         84_4                  16        83_4
 7         81_1                  17        Zif268
 8         81_4                  18        FH_bottom
 9         80_1                  19        CB_top
 10        80_2                  20        Myc_981

Making more cultures and plates of our expression plasmids

We picked two more colonies from plate 85 today and made 5 ml cultures from them. We also made 2 fresh cultures from the old 85 cultures, by taking 50 ul of old culture and 5 ml LB+spec. We will leave them overnight in the 37* shaker and perform minipreps and PCRs on them tomorrow.

We made positive control cultures from 81.1, 81.4, 80.1, and 80.2, in order to test our minipreps tomorrow. They reactions have a wide range of concentrations post-miniprep, and we are curious to see if the same will happen after performing a miniprep a second time.

Another way to figure out if our expression plasmids contain the appropriate insert is by using a restriction enzyme to cut it and then performing a PCR on the linear DNA. We had previously inserted 2 cutsites on our plasmids, Bsa1 (for insertion of finger 1) and Xba1. The lab already has Xba1, and we ordered Bsa1. Xba1 can be affected by methylation if it is preceded by 'GA' or followed by 'TC' [http://www.neb.com/nebecomm/products/faqproductR0145.asp#874]; we checked and our sequences should not be affected.

We also re-plated 78, 79, and 82 today, one set of plates with 1 ul of culture, and the other set with 10 ul.

Creating the 96 well test plate

Team Wolfe

SNOWMAN!

EcNR2 lambda red (Noah's prep):

• Noah remade the kan-ZFB-wp-hisura insert for us with the kan cassette in the opposite orientation from the his3 and ura3 genes. (The kan cassette is under a strong promoter and does not have a transcriptional terminator, so it's possible that RNA polymerase might keep transcribing through the end of kan and into his3.) He also used it for lambda red in EcNR2, and a couple of plates look like they may have a couple colonies.
• picked 4 colonies, diluted in 20µL H20 and used 1µL as template for 1529620 locus PCR. The rest was grown in LB+kan.

Lambda red with Noah's kanZFBhisura:

• We recently discovered that the kan plates we had been using were very old, and that might be why we got that weird crystalline lawn of colony-like things. We will retry lambda red in the ∆hisB∆pyrF∆rpoZ +pKD46 strain and see if this solves the problem
• 1.5mL cells divided in two: half for kan-his-ura (300ng) and half as a negative control (water)

Thio insert:

• In case lambda red also does not work, we will try to add phosphothioate bases to the insert, but only to the lagging strand 5' end (so only the Ura3 side). Since our primers will have very different melting temps, we will try 2 different reactions:
• Touchdown PCR:
  • template: Noah's kan-ZFB-hisura (163ng/µL) diluted to ~10ng per reaction (4 reactions)
  • primers: kan_f+homology, Ura3 R phosphothioate
  • 2 cycles at each annealing temperature (67, 66...57) for 11 cycles followed by 15 more cycles at 57; 3 min elongation
• Gradient PCR:
  • same as above but with 12 reactions, annealing temperatures from 57-67˚C
• Results: most of the gradient reactions produced a faint but clean band at 3kb. The touch down PCR had a stronger 3kb band but also lots of side products.

Team TolC

Primers

• Created and ordered primers in order to test the presence of MAGE rpoZ knockout oligo
  • Primers made are named
    • rpoZ_MAGE_KO plus 4, rpoZ_MAGE_KO minus 4, which have all 4 of the stop codons
    • rpoZ_MAGE_KO plus 2, and rpoZ_MAGE_KO minus 2, which have only the first two stop codons.

Kan Plates

• Performed control experiment on Kan plates by growing up liquid culture from glycerol stock and then spreading on Kan plate in order to determine the speed of growth and intensity of the presence of Kan on the plates
• Will check on these tomorrow.

Kan-ZFB-wp insertion

• Picked 5 colonies from ZF090 and ZF091 plates for a total of 10, ZF092 had too few colonies to pick from
  • Placed colonies in 20 μL of water and used 1 μl for a 20 μL PCR reaction
  • Then took 10 μL from 20 μL dilution and added to 100 μL of LB in 96 well plate and put in 30°C fridge, at 3:19 pm
  • Same protocol as KAPA PCR with the following changes made
    • Step 3, gradient for annealing, 55°C - 77°C, for a range of 55,57,59,61 and 63°C for the two rows of 5 PCR tubes each (placed leftmost)
    • Step 4, Extension, 1 min
    • Step 5, 25 cycles total
  • Name: TOLCGRAD, PCR5 machine.

July 19th

Team ZF

Checking on plates 78, 79, 82

Both the 10 ul and 1 ul essentially had a lawn of bacteria growing on them. We re-plated these samples, using 1/100 ul and 1/10000 ul of bacteria in 50 ul of LB. We will leave these plates to incubate overnight at 37*.

We also made a culture from the old 85 culture, which we will plate tomorrow.

Minipreps of colonies and controls

Our minipreps from Saturday had low yields, especially for culture 85. We suspect this is why the PCR [[#Gel analysis of miniprep junction PCR on Sunday did not work for this sample. Unfortunately, 85.3 and 85.4 did not grow even after being left in the shaker overnight. These were two cultures we made by picking new colonies from plate 85. This may have occurred because we did not actually pick the colony, or the colony was a cheater. Thus, we performed minipreps on 80.1, 80.2, 81.1, 81.4 (the controls, chosen for their wide range of concentrations after our first miniprep), and 85.1 and 85.2.

In order to figure our why our minipreps were resulting in unexpectedly low yields and increase our yields:

• We tested the pH of our water and Buffer EB.
  • The pH of our aliquot of water was ~4-5 (too acidic...we are unsure why)
  • The pH of our Buffer EB was ~7.
    • Ideally, the DNA should be eluted by a solution of pH 7, so we decided to use Buffer EB during the elution step.
• We also checked the copy number of the origin of replication used in our plasmids. ColE1 apparently has a low copy number, which might also explain our low yields.
• We had made 5 ml of culture in an attempt to increase our yields.

Our yields were larger than our first round of minipreps, although the purities were rather low. We decided to proceed anyway.

Concentration and purity of our miniprep product

PCR of miniprep products

We then ran a PCR for the cross-junction on all 6 (80.1, 80.2, 81.1, 81.4, 85.1, 85.2) samples, using our usual cross junction protocol.

Gel results, expected product size of 1.4 kb

We saw bands for samples 80.1, 81.1, 81.4, 85.1, and a very faint band for 85.2. The strange thing about these bands is that they appeared to be right around 1650 bp, larger than our 1.4 kb target size. We are unsure of the identity of these bands and will send them out for sequencing.

Starting a new plate for sample 85

Since we have been having such bad luck with sample 85, we seeded 2 ml of LB+spec with 100 ul of the transformed bacteria for sample 85. This is in preparation for making a new plate of sample 85 (the old plate was not a good spec plate and had lots of unspecific growth as well as very few colonies, so if we used this plate for more colony picking our choices would be very limited). This new plate should also give us more luck with picking colonies and having them actually grow in the LB+spec.

Designing ultramers for Zif268, OZ052, and OZ123

In preparation for designing our 96-well practice plate, we designed ultramers for our three positive controls Zif268, OZ052, and OZ123. These ultramers contain the Type II binding sites as well as the F2/F3 fingers. Since the practice plate will contain oligos that encode for F1, we can use these three positive controls to practice and ensure that we secure the technique of using the Type II binding sites to swap in F1 into our expression plasmids. The ultramers have not yet been ordered.

Team TolC

PCR to test insertion of KAN-ZFB-wp into ECNR2

• Made 26 dilutions of culture from three different recombineering plates
  • 10 cultures from Kan_tolC_locus_F1 (ZF090 plate) primer recombination
  • 10 cultures from Kan_tolC_locus_F2 (ZF091 plate) primer recombination
  • 5 cultures from Kan_tolC_locus_F3 (ZF092 plate) primer reecombination
  • 1 culture from an old Kan plate with recombination from last week
• 5 of ZF090, 6 of ZF091, and 5 ZF092 were placed in a PCR with 58˚C annealing temperature
• 5 of ZF090, 4 of ZF091, and 1 from old plate were run in a PCR with 62˚C annealing temperature
• primers used were TolC_seq_F and TolC_seq_R

• Chose colonies based on the intensity of the bands and grew up cultures of ZF091-2d, ZF091-4d, ZF090-1d, ZF091-5d, ZF090-1s, ZF090-2s, ZF090-3s, and ZF091-3s

Sequencing of Kan-ZFB-wp insertion

• Prepared 16 PCR products of the 8 cultures we chose to grow up in order to send out for sequencing
  • Used TolC_Seq_F and ZFB-wp-F primers
  • Bands looked a little small when ran out gel for longer

New MAGE oligo

• Constructed a new oligo for MAGE knockout of rpoZ, with oligos more than 4 mutations and substitutions the efficiency drops from 15% down to below 5%, so we created a rpoZ knockout oligo with only 2 substitutions
  • The new MAGE rpoZ knockout is rpoZ_MAGE_Subs
• Also ordered primers to test the presence of the knockout rpoZ_MAGE_Subs1+, rpoZ_MAGE_Subs1-, rpoZ_MAGE_Subs2+, rpoZ_MAGE_Subs2-

Team Wolfe

EcNR2 lambda red colony PCR results:

• PCR showed that colonies 1-3 had the insert while 4 did not. Yay! (Note that in the gel image, we accidentally cut off the 300bp band in lane 4)
• We will grow up a reinoculated culture of colony 1 for a glycerol stock. If the Wolfe strain keeps not working, we at least have the insert in an EcNR2 line and can hopefully MAGE out the other genes without too much difficulty.

pSR01 growth phenotype:

• We will try to used the plate reader again to compare the growth phenotypes of ∆HisB∆pyrF∆rpoZ and ∆HisB∆pyrF∆rpoZ+pSR01. Used the same media as last time but since we're using a 48 well plate, each well has 250µL media. We used 5 pSR01 colonies and one selection strain colony as a control.
• N.B.: this plate we are using is not necessarily meant for OD tests like this and may give some variable readings.

Lambda red results:

• Yesterday's lambda red, which used Noah's kan-ZFB-wp-hisura, has yet to produce colonies. We will leave the plates in longer in case any come up later.

Thio kanZFB:

• Since yesterday's lambda red may not have worked, we need to get the thio kan up and running. We ran out the touchdown PCR samples (since they have more DNA) and will gel extract.
  • 57.7ng/µL 260/280=1.98
  • 69.3ng/µL 260/280=1.98

July 20th

Team ZF

Checking on 1/100 ul and 1/10000 ul 78, 79, and 82 plates

We got colonies on all the plates, but the 1/100 ul plates look a bit crowded. On the other hand, the 1/10000 plates only have a few colonies. We decided to save both plates, and decide which to use later.

• Based on these results, a 1/1000 ul dilution might be best.

Check on 85 culture

There was no growth in our culture.

Later: It ends up that our ultramer from 85 (Pos Con 77) had an error in it. Instead of coding for fingers 2 and 3, it codes for fingers 1 and 2. We ordered a new ultramer, and we no longer need to work on 85.

Finalizing the practice plate

We decided on using a practice plate with 24 oligos, consisting of 18 target sequences, and 6 controls. Our 6 controls are Zif268, OZ052, OZ123, and 3 sequences from the CODA table. We will need to construct the expression plasmid for Zif268, OZ052, and OZ123. Their ultramers were ordered today.

Our 18 targets were GNN/TNN sequences, which are more likely to have a binder, and were distributed among the backbones. The target and control groups each have their own set of primers, to facilitate picking them from the pool.

Expression Plasmid Sequencing Results

We got back our sequencing results:

Name	ID	Final?	Notes
FH Top (77)	1	N	1 snp
	2	N	5 snps
	3	Y	G -> C. Still Ala
	4	N	1 snp
FH Bottom (78)	1	N	1 Deletion at 1746, last nucleotide of F of FQRICMRN
CB Top (79)	1	N	A lot of deletions/mistakes in f2/f3 region
CB Bottom (80)	1	Y
	2	Y	G->C. Stiil Ala
	3	N	deletion 1613-1631
	4	N	many mistakes at end, may be ok
Myc 198 (81)	1	Y
	4	Y	G->C. Still Ala.
Myc 981 (82)	1	Y
Pos Con 16 (83)	4	Y	G->C. Still Ala.
	2	N	A lot of deletions/mistakes in f2/f3 region
	3	N	A lot of deletions/mistakes in f2/f3 region
Pos Con 55 (84)	1	Y (?)	Right sequence, but messy trace
	4	N	at 547: deletion at type II binding site at 665: deletion at beginning of F3
Zif 268	1	Y

Summary:

Good: 77.3, 80.1, 80.2, 81.1, 81.4, 82, 83, 84.1 (?), Zif268

Bad (Redo): 78, 79

We picked 4 new colonies for 78, and 79 since their sequences had many errors. We left these cultures overnight at 37* in the shaker.

Construction of OZ052 and OZ123: Joining the Finger with Homology regions

Previously, we did a PCR to reassemble the ultramers for OZ052 and OZ123, but they only coded strictly for F1/F2/F3 and did not have any overhang homology with any surrounding code. Thus, we performed PCR to add these homology overhangs so that we can integrate them with the omega subunit as well as the spec backbone to create a final expression plasmid.

The program we used was 55* annealing temperature, and a 15 second extension time. Gel results pictured below.

Overlap PCR to extend ultramers with homologies

We had an expected product size of 400 bp., which we can see in the gel. Bands are a little weird since there are bands heavier than the heaviest theoretical band (which is the strong product). We will do a gel extraction tomorrow to get rid of these bands to obtain pure product for use in the isothermal assembly.

Team TolC

rpoZ MAGE knockout

• Ran two rounds of MAGE on 4 ECNR2 cultures with the kan-ZFB-wp insertion using Noah's rpoZ knockout oligo
  • Grew cultures up to mid-log in kan+amp and LB
  • Four cultures are ZF091-2d, ZF091-4d, ZF090-1d, and ZF090-5d
  • Electroporator read 5.4 ms for all four cultures in first round
  • Could not do a third round of MAGE since the E.Coli do not appear to have recovered, and are nowhere near midlog (MAGE round 2 was done by 5:15pm and the cultures were checked at 8:30pm). Will let the culture go on overnight.
  • Put 50ul of a 1:100 dilution of each culture on Amp plates. Used a spreader for plates 1&2 and glass beads for plates 3 & 4.

Glycerol Stocks

• Made 4 glycerol stocks of the cultures sent to be sequenced
  • ZF090-1s, ZF090-2s, ZF090-3s, ZF091-3s

convinced that the gradient PCR machine is out of order, ought to inform Andrew

Team Wolfe

IPTG Plate and the Plate Reader

• Technical delays have allowed us only a few hours worth of plate reading for a 46-well plate with selection strain + pSR01 in LB+Amp +/- IPTG, NM+His +/- IPTG, NM +/- IPTG, and NM+3-AT +/- IPTG. Strains used: ∆HisB∆pyrF∆rpoz+pSR01 (5 colonies) and ∆HisB∆pyrF∆rpoz (1 colony).
  • The plate had a noticeable white residue under the lid around around the edges. We believe this was due to flaking of the plastic cover from vibration in the plate reader.
  • Cell growth in the plate suggested that IPTG is killing our cells since few cultures survived with IPTG and those that did (LB+Amp) grew less than the equivalent cultures without IPTG.

New Plate Without IPTG

• On plate reader at 11:30AM
  • Strains used: Water as control, Selection (Wolfe) Strain, Selection Strain + pSR01
  • Media Used: LB+Tet (LB+Amp for SS+pSR01),NM+His, NM, NM+3-AT (1µM), NM+3-AT (2.5µM), NM+3-AT (5µM).

Lambda Red Same procedure as usual

• Added ~350ng of Thio-Kan-ZFB-wp-His3-Ura3
• Used "new cuvettes"
• Negative water control

Plate Reader Update TEMPORARILY OUT OF SERVICE

Your worst nightmare

http://www.youtube.com/watch?v=v4o8MDjuu-A

July 21st

Team ZF

Checking colonies 78 and 79

All of the cultures grew overnight, so we performed a miniprep on them to obtain the plasmids.

Plasmid concentrations after miniprep

Our concentrations were better than they have been in the past; notably, after the addition of buffer P2, our solution actually turned a bright blue (indicating lysis of the cells), which we had not seen before.

We then ran a PCR on our miniprep product, to check for our desired insert. We used our usual protocol for a PCR of the expression plasmid cross-junction.

PCR results, note that some lanes do not show strong bands

Some of the products did not show up very strongly, but we sent them out for sequencing in case it was a PCR/gel error.

Sending out our expression colonies for sequencing

We sent out the samples from yesterday that had no more than 1 SNP for reverse sequencing. In addition, we also sent out 78 and 79 for forward and reverse sequencing.

• Reverse sequencing: 77.1, 77.3, 77.4, 78.1, 80.1, 80.2, 80.4, 81.1, 81.4, 82.1, 83.4, 84.1, 84.4, Zif268
• Forward and reverse sequencing: 781, 78.2, 78.3, 78.4, 79.1, 79.2, 79.3, 79.4

For sequencing, we used the forward primer pZE23G_3581_F CCAACCTTACCAGAGGGCGC (Junction forward) and the reverse primer pZE23G_2123_R CGAACGACCTACACCGAACT (Junction reverse)

We did a PCR of the sequences from yesterday that we want sequenced again.

PCR results, looking good

The bands were clear, and we will send these products to be sequenced.

Gel Extraction and Isothermal Assembly of OZ fingers+homology

We ran a gel extraction of our PCR product from yesterday, so that we could use it for isothermal assembly later. Strangely, we got bands that were larger than our largest theoretical product.

Prepare yourself to be gel-extracted

We had the following yields from our gel extraction:

 ID         Conc. (ng/ul)            260/280
 OZ052      96.3                     1.93
 OZ123      125.5                    1.91

Based on these concentrations, we used the following recipes for our isothermal reaction:

• OZ052:
  • Spec: 0.63 ul
  • OZ052: 1.56 ul
  • Omega: 0.13 ul
  • Water: 1.56 ul
  • Isothermal assembly solution: 7.5 ul
• OZ123:
  • Spec: 0.63 ul
  • OZ123: 0.14 ul
  • Omega: 0.13 ul
  • Water: 1.60 ul
  • Isothermal assembly solution: 7.5 ul

We left the isothermal assembly product in the -20* freezer, and will perform the transformation tomorrow.

Team Tolc

Team Wolfe

• Lambda red culture did not grow colonies overnight on a kanamycin plate. This may be due to a low time (4.8ms) during the electroporation.
• Repeated lambda red using the same procedure. Got a similar time constant and noticed that the water negative control had more cells than the culture containing the insert, but we went ahead and plated 1mL of each on kan plates.
• Also replated the 7/20 lambda red culture to see if we can get any good cells (1.5mL).

July 22nd

Team ZF

Sequencing Results of Expression Plasmids

The good news is that we managed to get a perfect sequence for each of our plasmids. The bad news is that we do not know which sequences are the matches, since the names are all scrambled for some reason (i.e. sample 78.x does not align with FH bottom like it should, but instead aligns perfectly with another plasmid sequence). We will thus need to resend our samples for sequencing to be able to choose the correct plasmids that match. Below is a summary of the scrambled data from the sequencing we sent in yesterday:

ID	Is a perfect match with	Notes
Myc 198 (81)	78.2, 78.3
FH Top (77)	81.4, Myc 981	83.4 has 1 deletion
CB Bottom (80)	84.4	78.1 has 5 deletions; Zif has 1 deletion
FH bottom (78)	n/a	84.1 deletion at beginning of F3
CB Top (79)	79.3
Myc 981 (82)	78.4
Zif 268	79.4
Pos Con 55 (83)	79.2	79.3 has deletion at beginning of F3
Pos Con 16	79.1

To this end, we redid the PCRs for everything in preparation for the resequencing, using the junction primers and the previous protocol. The resulting gels can be observed below:

E-gel showing bands for samples 78.1-78.4 and 79.1-79.4, expected size of 1.4 kb

Remaining samples, expected size of 1.4 kb

From these PCRs, all the reactions look like they produced bands of the right size, a good indicator that the isothermal assemblies worked. Only sequencing will tell whether they are truly the products that we are looking for.

We sent these samples out for sequencing, making sure that all the samples were in the appropriate tubes.

Transformation for OZ plasmids

Today, we took the results of the isothermal assembly from yesterday and did chemical transformation to introduce the plasmids into the Top 10 ChemComp bacteria, using our protocol for chemical transformations. They were left to recover for approximately 1.5 hours. We plated 2 dilutions, 10 ul and 50 ul, and left them overnight at 37* in the incubator.

Team Wolfe

• Yesterday's lambda red plate had several large colonies--but so did the negative control plate. We will go ahead and do a PCR of the 1529620 locus (as previously described) on 12 of the colonies in case one of them happens to have the insert. The colonies were also grown up simultaneously in LB+kan.
  • Results: all of the colonies were cheaters

• In case these colonies do not have the insert, as we suspect, we will repeat lambda red with the thio kan-ZFB-wp-his3-ura3 insert
  • 1mL culture for each condition, 210 ng DNA
  • time constant for thio insert sample was 5.0

Team TolC

Gel for Jun's MAGE rpoZ, rowD

• The gel appeared to have bands, so we are running a second PCR to confirm it

July 23rd

Team Wolfe

• Lambda red results: no real colonies, only cheaters.

July 24th

Team ZF

Sequencing Results

We got back our sequencing results from the samples we sent out on Friday, and the results are summarized in the table below. The checkmarks indicate whether the sample is adequate for usage or not.

	FH top (77)	Notes
✓	77.1	Only G -> C in ala
✓	77.3	Only G -> C in ala
	77.4	Single deletion in F3
	FH bottom (78)
	78.1	Many, many SNPs throughout, oddly F and R differ
	78.2	Many, many SNPSs, R starts in a strange place
	78.3	Four deletions throughout on both F and R
	78.4	Many, many SNPs throughout
	Original	Only one SNP in F3, but unacceptable
	CB top (79)
	79.1	Many, many SNPs and deletions throughout, F and R the same
✓	79.2	No SNPs
✓	79.3	No SNPs
	79.4	G -> C in ala, deletion in the Q of the F3 \"FSQ\"
	CB bottom (80)
✓	80.1	No SNPs
	80.2	G -> C in ala, deletion in the homology region shortly after F3 ends
	80.4	G -> C in ala, five deletions in F3/homology region
	Myc 198 (81)
✓	81.1	No SNPs
✓	81.4	Only G -> C in ala
	Myc 981 (82)
✓	82.1	Only G -> C in ala
	Pos con 16 (83)
✓	83.4	Only G -> C in ala
	Pos con 55 (84)
✓	84.1	Only G -> C in ala
	84.4	G -> C in ala, two deletions
	Zif268
✓	Zif268	No SNPs

July 25th

Team TolC

Sequencing of Jun's rpoZ MAGE knockout

• Prepared six products and primers for sequencing
  • Sending Jun colony 4, PCR's 1-mutant_R, 2-mutant_R, 3-mutant_R, 4-mutant_R, 2-mutant_Int_R, and 4-mutant_Int_R
  • delayed until tomorrow (July 25, 2011) because pickup for the day already done.

Lambda Red Recombination of zeocine into TolC(assistance from Naomi, Cub team member)

• PCR out zeocin cassette (replacing the rpoZ, for selection) from Wolfe Strain
  • Used primers rpoZ_F and rpoz_R, expecting a band about 1500bp? Total length about 939bp, including the promoters, according to http://rothlab.ucdavis.edu/drugs/zeo.html Roth lab @ UC Davis, Zeocin
  • Ran 8, 25 µL solutions with KAPA
  • PCR protocol(PCR 7 machine, "ZEOC")
    • 95˚ C, for 5 min
    • 98˚ C, for 20 sec
    • 62˚ C, for 15 sec
    • 72˚ C, for 45 sec
    • Repeat 29 times
    • 72˚ C, for 5 min
    • 4˚ C, forever
  • Gel extracted the PCR product NOTE. Since the gel, was so clean, we may do a PCR clean up next time, instead of running the PCR product through a gel for gel extraction. Just make sure to use these exact same parameters.
    • Nanodrop
      • 156.2 ng/µL and 107.6 ng/µL, each in 30ul of water (distilled, deionised- molecular grade)
• Performed lambda red recombination
  • Time constant of 5.6 ms

rpoZ MAGE knockout attempt...yet again

• Used new oligo to perform a MAGE knockout of rpoZ
  • Oligo named rpoZ_MAGE_Subs
• Electroporator read 5.2 ms
• Allowed for 3 hours of growth and spread on zeocine plate

Team Wolfe Cub

• Plate reader is still being repaired--we will have to wait to check the growth curves
• Since plans A and B are not working well at the moment, we will go ahead and start preparing for plan C (using a plasmid). Ordered primers that will clone out the pSB4K5 (a biobrick vector with a kan cassette, http://partsregistry.org/Part:pSB4K5) backbone with homology to the ZFB-wp-his3-ura3 construct. We will then connect the two with Gibson assembly.
  • To this end, we need to use the biobrick DNA sent to us to transform chemically competent E coli. Unfortunately the 384-well plates that they are stored in could not be found because Andrew is out of town--hopefully they will turn up tomorrow.
• For the rest of the day, we joined team TolC for gel extraction, MAGE, and lambda red!

Team ZF

Result of OZ052 and OZ123 Transformation

Last Friday we plated out the transformed bacteria for the two OZ controls in 10 ul and 50 ul volumes. They both yielded colonies, but the 10 ul plates only had a handful while the 50 ul plates had around 15-20 colonies each. We picked four colonies from each plate and grew them in LB/spec so that tomorrow we can perform a miniprep and send them off for sequencing. We should know the final verdict by Wednesday regarding which ones are good or bad.

Glycerol stockmaking

We got the sequencing results back from last Friday, and took the following colonies to make into glycerol stock solutions: 77.1, 79.2, 80.1, 81.1 (x2 for both FH bottom and Myc 198), 82.1, 83.4, 84.1, Zif268. These colonies are a subset of the "good" colonies from our sequencing results from Sunday. We mixed 120 ul of bacteria in mid-log with 300 ul of 80% glycerol to make the final solution, which was stored at -80 degrees C.

Restriction enzyme test

We tested both XbaI and BsaI on the junction PCR product using colony 79.4 as a template (which was used because it was a "bad" sequence overall but had intact BsaI and XbaI cut sites). The junction PCR product is 1326 bp, and we expected to see bands of 593 and 739 bp with XbaI, and 717 and 578 bp with BsaI. Our restriction digest recipe consisted of the following per reaction:

• 1 ul 10X buffer (NE biolabs buffer 4)
• 7.9 ul H2O
• 1 ul DNA (~100 ng)
• 1 ul enzyme (~2 units)
• 1 ul BSA (100x)

The two gels we ran for this digest showed that XbaI did NOT work, which may be due to XbaI being too old. However, we did get double bands both times for BsaI. Our egel was strange because of uneven loading, and so we were unable to determine the true size of both bands, but the agarose gel we ran later showed the two bands in the right positions. The two gels can be seen below:

E-gel of our first digestion. The gel looks unusual (notice the bubble-like formation), so we performed a second digestion.

1% agarose gel of our second digestion. Although the bands are faint, we can see the appropriately sized bands for Bsa1.

Ultramer Construction of Pos Con 77 and Other F2/F3 positive controls

We redid the ultramer overlap PCR for Pos Con 77, this time with the correct reverse sequence. We also assembled ultramers for Zif268, OZ052 and OZ123 (these are the plasmids that will have the type II cut sites in them along with F2/F3 only, as opposed to having the entire finger already assembled). For the Zif268 reaction, an annealing temperature of 65*C was used, and for the rest, the annealing temperature was 58*C. For all reactions, the extension time was 15 seconds.

The following primers were used for each reaction (index taken from the Dropbox primer index):

• Pos con 77 - 76, 122
• Zif268 - 123, 124
• OZ052 - 76, 125
• OZ123 - 76, 126

July 26

Team ZF

Isothermal Assembly of Pos Con 77, Zif 268, and OZs

Today we checked the PCR products of the ultramer reaction from yesterday. They did not look good. We repeated the reaction using a touchdown PCR beginning with an annealing temperature of 70 degrees and decreasing 2 degrees every other cycle until hitting a minimum of 58 degrees, and we brought the total number of cycles to 25. Extension time was 30 seconds. This looked great. The pictures for the two reactions can be seen below:

Our first PCR was extremely streaky, so we decided to redo it.

We did a touchdown PCR, and our product looks better, although it's still streaky.

Before the isothermal assembly, we did a PCR purification and measured the concentrations of the ultramer reaction products:

Concentrations of our PCR product after PCR purification. This was used in our isothermal assembly.

We then performed an isothermal assembly, using the following mix for Pos con 77, OZ052, and OZ123:

• 0.63 ul of spec backbone at ~157 ng/ul
• 0.3 ul of ultramer (~50 ng/ul)
• 0.13 ul of omega subunit/linker
• 1.44 ul of H2O
• 7.5 ul of isothermal mix

For Zif268:

• 0.63 ul of spec backbone
• 0.19 ul of Zif (~90 ng/ul)
• 0.13 ul of omega/linker
• 1.55 of H2O
• 7.5 ul of isothermal mix

This was left at 50 degrees for an hour, then stored at 4 degrees.

Prepare control OZs for sequencing

We performed a miniprep on the eight samples for sequencing, obtaining the following concentrations:

Our OZ concentrations after miniprep.

The miniprep lysis step looked good, and the samples turned blue after lysis.

We then performed a junction PCR using the previous protocol, and checked the products on a gel:

Gel of our PCR product that we sent out for sequencing.

They looked good, so we sent them out for sequencing. Hopefully we will have our final OZ control plasmids for tomorrow.

Practice Plate resuspension

We resuspended the practice plate oligos in 40 ul of water to produce a 100 uM solution, taking 10 ul of the final solutions into 90 ul of water in separate tubes to create 10 uM working concentrations. When we receive our tag primers, we should be able to test the presence of the oligos in each tube as well as amplify them in preparation for integration into the expression plasmids.

Colony finalization

For the colonies that we plated yesterday, we saw that the plates all had good growth on them and so we wrapped the plates in parafilm and put them at 4 degrees for storage. 1/1000 ul from saturated culture seems to be a good amount to plate.

Team TolC

Zeocin insertion into ECNR2

• Plated 3 mL of our recombination culture on zeocin plate, and also plated 2 mL of MAGE results on zeocin plate as a control
  • The recombination plate had about 15 colonies around 9 30am, and the MAGE plate had none
• Continued by PCR of 4 colonies on recombination plate
• Each template was analysed with presence of different sized bands for rpoZ (using rpoZ_F and rpoZ_R) and presence of Zeocin cassette (using rpoZ_R and zeocin_R)
• Gel resulted with the following:

• • SUCCESS!!! Yippee!!!
  • NOTE. Since there was a bit of non specific annealing, we might want to use a higher annealing temperature of 64C instead of 62C
• Decided to run PCR for the Kan insertion just to make sure it was still present in the 4 colonies we chose, and it is!!!

WERE READY TO ROOOCCKKK!!!!!

MAGE rpoZ knockout

• Plated 1:10 and 1:100 dilution of MAGE results, and this morning at 10 am, they both had cells and in appropriate proportions
  • If above PCR and gel of zeocin insertion does not appear to be successful, then we will run 50 PCR on 50 different colonies on the 1:100 dilution plate of MAGE rpoZ knockout

Team Wolfe

• Plate reader: trying to get in contact with Christian Daly who runs the Spectramax plate reader in the Bauer facility (Northwest basement). Hopefully we will get access soon.
• Selection system plasmid: still trying to get hold of the biobricks. Designed Quikchange primers to change the zinc finger binding sites.
• Lambda red recombination: gave lambda red one last chance, this time with a positive control
  • negative control (water): plated 1mL
  • positive control (kan cassette from Wyss): 50ng DNA, plated 1mL and 100uL
  • thio kan-ZFB-wp-his3-ura3: 180ng DNA, plated 1mL

July 27th

• Impromptu meeting for all teams, TFs, and advisors in NW labs basement, to discuss "how we will move forward to test the selection, now that we have a TolC strain that should work for selection and a His3Ura3 plasmid-based selection that is almost complete," and to lay out and assign a lab to-do for iGEM parts, selection systems, and what to do in preparation for The Chip to arrive/backup plan in case it arrives too late (see notes in the dropbox under "Selection Meeting 7-27-11.docx")

Team TolC

Culture of TolC+Kan-ZFB-wp+Zeocin

• Did not realize that colonies needed to be grown up without antibiotic before being grown in Kanamycin, so all the three colonies from yesterday passed away and didn't make it through the night :(, so we grew up 4 more colonies and ran PCR and gel to solidify the presence of the necessary insertions

Team ZF

Checking the OZ sequencing results

	OZ052	Notes
✓	1	No snps
✓	2	No snps
✓	3	No snps
	4	Deletion at F1
	OZ123	Notes
✓	1	No snps
	2	deletion in omega linker
✓	3	No snps
✓	4	No snps

We made glycerol stocks and final plates from 0Z052.1 and OZ123.1.

Transformation of Pos Con 77, OZs, Zif 268

We transformed Top 10 One Shot Electrocomp bacteria with our isothermal assembly product from yesterday. We let the cells recover for an hour, and plated 50 ul, leaving them at 37* overnight.

Team Wolfe

• Morning meeting: Since TolC has gotten their selection system onto the genome, our priorities are now going to be making the plasmid-based Wolfe selection system and getting data on the plate reader. We also will eventually try to use a genome-based selection system but using the EcNR2 strain (oligos have been ordered)

Plate Reader:

• We took a trip downstairs to B2 and were trained to use the Bioscreen plate reader in the Bauer Core facility. We now have access to a working plate reader!
• Bioscreen uses a 100-well honeycomb plate, so the organization was as follows:
  • Well 1, 11, 21, etc: LB+tet
  • Well 2, 12, 22, etc: NM+his
  • Well 3, 13, 23, etc: NM
  • Well 4, 14, 24, etc: NM+1mM 3-AT
  • Well 5, 15, 25, etc: NM+2.5mM 3-AT
  • Well 6, 16, 26, etc: NM+5mM 3-AT
  • Well 7, 17, 27, etc: LB+tet+100µM IPTG
  • Well 8, 18, 28, etc: NM+IPTG
  • Well 9, 19, 29, etc: NM+1mM 3-AT+IPTG
  • Well 10, 20, 30, etc: NM+5mM 3-AT+IPTG
  • Column 1: no cells
  • Column 2-3: ∆HisB∆pyrF∆rpoZ
  • Columns 4-10: ∆HisB∆pyrF∆rpoZ+pSR01

Electrocomp Transformation

• Used Team ZF's protocol to transform electrocompetent cells with two of the pSB4K5 plasmids found in our biobricks plates (2:17H and 3:11P)
• Used 10µL ddH2O to resuspend DNA in biobrick plate wells and transferred to eppendorf.
• 2µL DNA (which, interestingly, was red...)
• plated 10µL and 100µL of each on kan plates

Quikchange primers:

• Realized that we may need to consider the bases on either side of the zinc finger binding site, so we will check this and put off ordering another day.