Team:EPF-Lausanne/Our Project/Data

From 2011.igem.org

(Difference between revisions)
(TetR - RFP)
(Summary)
 
(69 intermediate revisions not shown)
Line 1: Line 1:
{{:Team:EPF-Lausanne/Templates/Header|title=Data}}
{{:Team:EPF-Lausanne/Templates/Header|title=Data}}
-
 
-
team, please check this page: [https://igem.org/Sample_Data_Page]
 
-
== New parts ==
+
== Overview ==
-
we must have 3 favourite, then the others come in a "other biobrick" section
+
=== Summary ===
-
=== Medium-strength Plac ===
+
[[File:EPFL-Summary_drawing.png|right|thumb|250px]]
-
blablabla
+
Three components constitute our transcription factor development pipeline. The first is a selection system which lyses cells containing strong matches between a mutated transcription factor and its promoter and allows for the speedy recovery of the relevant DNA. The second component is an ''in vivo'' characterization system that uses two different reporter systems as a way to document the binding affinities of the TetR transcription factor and its promoter pTet. The third component is an ''in vitro'' characterization system called MITOMI that allows high-throughput quantitative analysis of DNA-protein interaction strengths.
-
=== TetR Mutants ===
+
In developing these three pillars, a number of parts were made. We have listed all of them here and have highlighted our favorites.
 +
=== Systems ===
-
* V36F
+
'''Selection System''': We cloned the Berkeley Lysis cassette (BBa_K112808) under control of the T7 promoter into a low copy number plasmid (pSB3K1, formerly BBa_I739202).
-
''Sequence''
+
'''In Vivo Characterization''': We cloned an RFP gene under control of T7 promoter variants (parts BBa_K613001 through BBa_K613012) into a low copy number plasmid (pSB3K1, formerly BBa_I739202). We also cloned TetR mutants (parts BBa_K613013 through BBa_K613019) into a  a low copy number plasmid (pSB3K1, formerly BBa_I739202). Both sets of plasmids were thoroughly characterized using IPTG platereader experiments.
-
ATGTCCAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTTTCGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCT
+
'''In Vitro Characterization''': We characterized TetR mutants (parts BBa_K613013, BBa_K613015, BBa_K613016, BBa_K613017, BBa_K613019) in the low copy number plasmid pSB3K1 (formerly BBa_I739202).
-
* P39K
+
== Favourite parts ==
-
* Y42F
+
Our three favourite parts are TetR mutants, characterised ''in-vivo'' using our reporter systems, and ''in-vitro'' by MITOMI.
-
* P39Q-Y42M
+
* [http://partsregistry.org/Part:BBa_K613015 BBa_K613015] '''TetR E37A W43S T141A mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613016 BBa_K613016] '''TetR P39K mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613017 BBa_K613017] '''TetR Y42F mutant'''
-
''Sequence''
+
== Pre-existing parts characterised ==
-
ATGTCCAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTGTAGAGCAGCAAACAGTGATGTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCT
+
* [http://partsregistry.org/Part:BBa_K112808:Experience BBa_K112808 Experience Page] - '''The Berkeley Lysis Device''': In developing our Lysis selection device, we characterised induction, and ran proof-of-principle experiments.
-
=== T7 promoter variants ===
+
== All other parts submitted ==
 +
=== TetR Mutants ===
-
== Pre-existing parts ==
+
In addition to our three favourite tetR mutants, we created these four:
-
add something about the lysis cassette, and add also on its page on the partsregistry!
+
* [http://partsregistry.org/Part:BBa_K613013 K613013] '''V36F mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613014 K613014] '''V36F W43S mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613018 K613018] '''Y42F K108E mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613019 K613019] '''P39Q Y42M mutant'''
-
== DNA recovery ==
+
=== T7 Promoter variants ===
-
Vincent, you could drop your nice explanations & graphs in here :)
+
We submitted a family of T7 promoters with varying strength. Our lysis selection device uses what we refer to as the wild-type (100% reported strength) T7 Promoter:
-
I guess the "Characterization of Variants Using Fluorescence" should go with the T7 promoters biobricks
+
-
== T7 Promoter Variants ==
+
* [http://partsregistry.org/Part:BBa_K613001 K613001] '''T7 Promoter''', 100% reported strength
-
=== Characterization of Variants Using Fluorescence ===
+
In addition, we submitted the following mutants:
-
For each family, we tested the randomers and the designed variants separately. To characterize the promoter strengths, we used RFP as the reporter gene and used a platereader to test for fluorescence during and after induction with IPTG.
+
Variants without additional lac operator (constitutive):
-
[[File:non_random_dose_response.png|700px]]
+
* [http://partsregistry.org/Part:BBa_K613002 BBa_K613002] '''T7 Promoter''', 14% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613003 BBa_K613003] '''T7 Promoter''', 30% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613004 BBa_K613004] '''T7 Promoter''', 54% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613005 BBa_K613005] '''T7 Promoter''', 80% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613006 BBa_K613006] '''T7 Promoter''', 111% reported strength
-
The six designed T7 promoter variants are named as a function of their predicted promoter efficiency, relative to the wildtype. For example, T7 14 has a predicted efficiency of 14% compared to the consensus T7 promoter, whereas T7 111 is predicted to be 111% more efficient than the wildtype. In the chart above, you find each of the designed promoter variants for both the T7 with and without the lac operator, arranged in increasing predicted efficiency. Contrary to our expectation, some variants that were designed to have a lesser efficiency than the wildtype (e.g. T7 54) seem to have a much higher strength (as measured by fluorescence at saturation, normalized by the optical density). Already in the designed variants, we see a substantial difference in the behaviour of the promoters that have a lac operator as opposed to those that do not. The data for this graph was produced in triplicate, so the error bar represents the standard error across those three measurements.
+
Variants with additional lac operator (LacI repressed):
-
[[File:induction_ratio.png|700px]]
+
* [http://partsregistry.org/Part:BBa_K613007 BBa_K613007] '''T7 Promoter, LacI repressed''', 100% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613008 BBa_K613008] '''T7 Promoter, LacI repressed''', 14% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613009 BBa_K613009] '''T7 Promoter, LacI repressed''', 30% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613010 BBa_K613010] '''T7 Promoter, LacI repressed''', 54% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613011 BBa_K613011] '''T7 Promoter, LacI repressed''', 80% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613012 BBa_K613012] '''T7 Promoter, LacI repressed''', 111% reported strength
-
In addition to fluorescence at saturation, another way to characterize promoter strength is to look at its induction ratio, which is the ratio, at saturation, of fluorescence produced by induction with IPTG versus fluorescence produced without induction. In layman's terms, it indicates how strongly the promoter reacts to induction. Here again, our results indicate that some promoter variants (T7 80 in particular) stand out with respect to this feature. Here too the importance of the lac operator in producing high induction ratios is not to be underestimated. 
+
=== Medium-strength Plac ===
-
 
+
-
 
+
-
 
+
-
[[File:varability_comparison.png|200px| left]]
+
-
 
+
-
For the three sets of randomers for T7 with and without the lac operator, we tested seventy-two different variants and characterized their expression using the same IPTG induction protocol as with the designed variants. The goal of using these variants was to examine the range of expressions that can be produced by random mutations as opposed to directed mutations. The results, as presented in the graph, indicate that the designed variants (with and without lac operator put together) produce a much higher average normalized fluorescence than the randomers.
+
-
 
+
-
=== Characterization and DNA Recovery with Lysis ===
+
-
 
+
-
Since a major component of our scheme for selecting promoters and transcription factors with strong binding affinities required the ability to lyse cells, we also wanted to test a T7-driven lysis cassette.
+
-
 
+
-
[[File:lysis_dynamics.png|700px]]
+
-
 
+
-
Induction with various concentrations of IPTG reveals a steady increase in the amount of lysis that can be obtained. Here 500 uM yields the most substantial amount of lysis, and that concentration was used in all further experiments dealing with lysis. The negative controls were two-fold: one is an unsuccessful attempt at inserting the lysis cassette downstream of a T7 promoter in the psB3K1 plasmid, while the other is a T7 promoter upstream of an RFP gene. Neither should express lysis.
+
-
 
+
-
[[File:dose_response.png|700px]]
+
-
 
+
-
== In vivo characterization - Readout systems ==
+
-
 
+
-
We created two different readout systems to characterize TetR mutants ''in vivo''. This is the last step of our whole method, after having selected the interesting TetR-Ptet mutant pairs with the lysis device and having characterized them ''in vitro''.
+
-
 
+
-
=== TetR - RFP ===
+
-
 
+
-
The first readout system is composed of TetR with a constitutive promoter, followed by RFP with a Ptet promoter. If TetR '''binds''' to Ptet, then RFP is ''' repressed'''. For more details about them and the experimental results, please refer to the [https://2011.igem.org/Team:EPF-Lausanne/Our_Project/Assembly#TetR_-_RFP_system Reporter systems] page.
+
-
 
+
-
[[File:EPFL_2reporters_ss.JPG|400px]]
+
-
 
+
-
=== TetR - LacI - RFP ===
+
-
This second readout system is composed of 3 genes: TetR under Pconst control, LacI under Ptet control (playing the role of an inverter) and finally RFP under pLac control. Here, RFP is '''induced''' when TetR '''binds''' to pTet. You can see the experimental results on the [https://2011.igem.org/Team:EPF-Lausanne/Our_Project/Assembly Reporter systems] page.
+
We submitted a new Plac promoter of medium strength. We characterized it with ATC inductions, using RFP as a readout.
 +
* [http://partsregistry.org/Part:BBa_K613000 BBa_K613000] '''pLac promoter''', medium strength
-
[[File:EPFL_3reporter_ss.JPG|400px]]
 
{{:Team:EPF-Lausanne/Templates/Footer}}
{{:Team:EPF-Lausanne/Templates/Footer}}

Latest revision as of 22:05, 28 October 2011