Team:EPF-Lausanne/Our Project/Data

From 2011.igem.org

(Difference between revisions)
(→Characterization with Lysis)
(→Summary)
 
(85 intermediate revisions not shown)
Line 1: Line 1:
{{:Team:EPF-Lausanne/Templates/Header|title=Data}}
{{:Team:EPF-Lausanne/Templates/Header|title=Data}}
-
That's how the Data page should look like: https://igem.org/Sample_Data_Page
+
== Overview ==
-
Perhaps we could only provide the link to the Registry page; if we put all the graphs here it's gonna be messy pages (TetR mutants, reporter plasmids and T7 variants)
+
-
We can make a "results" page with all the graphs, or put them in the descript
+
-
== New parts ==
+
=== Summary ===
-
=== Medium-strength Plac ===
+
[[File:EPFL-Summary_drawing.png|right|thumb|250px]]
-
blablabla
+
Three components constitute our transcription factor development pipeline. The first is a selection system which lyses cells containing strong matches between a mutated transcription factor and its promoter and allows for the speedy recovery of the relevant DNA. The second component is an ''in vivo'' characterization system that uses two different reporter systems as a way to document the binding affinities of the TetR transcription factor and its promoter pTet. The third component is an ''in vitro'' characterization system called MITOMI that allows high-throughput quantitative analysis of DNA-protein interaction strengths.
-
=== TetR Mutants ===
+
In developing these three pillars, a number of parts were made. We have listed all of them here and have highlighted our favorites.
-
Lilia, are you also putting the WT into biobrick?
+
-
* V36F
+
=== Systems ===
-
''Sequence''
+
'''Selection System''': We cloned the Berkeley Lysis cassette (BBa_K112808) under control of the T7 promoter into a low copy number plasmid (pSB3K1, formerly BBa_I739202).
-
ATGTCCAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTTTCGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCT
+
'''In Vivo Characterization''': We cloned an RFP gene under control of T7 promoter variants (parts BBa_K613001 through BBa_K613012) into a low copy number plasmid (pSB3K1, formerly BBa_I739202). We also cloned TetR mutants (parts BBa_K613013 through BBa_K613019) into a  a low copy number plasmid (pSB3K1, formerly BBa_I739202). Both sets of plasmids were thoroughly characterized using IPTG platereader experiments.
-
* P39K
+
'''In Vitro Characterization''': We characterized TetR mutants (parts BBa_K613013, BBa_K613015, BBa_K613016, BBa_K613017, BBa_K613019) in the low copy number plasmid pSB3K1 (formerly BBa_I739202).
-
* Y42F
+
== Favourite parts ==
-
* P39Q-Y42M
+
Our three favourite parts are TetR mutants, characterised ''in-vivo'' using our reporter systems, and ''in-vitro'' by MITOMI.
-
''Sequence''
+
* [http://partsregistry.org/Part:BBa_K613015 BBa_K613015] '''TetR E37A W43S T141A mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613016 BBa_K613016] '''TetR P39K mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613017 BBa_K613017] '''TetR Y42F mutant'''
-
ATGTCCAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTGTAGAGCAGCAAACAGTGATGTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCT
+
== Pre-existing parts characterised ==
-
== T7 Promoter Variants ==
+
* [http://partsregistry.org/Part:BBa_K112808:Experience BBa_K112808 Experience Page] - '''The Berkeley Lysis Device''': In developing our Lysis selection device, we characterised induction, and ran proof-of-principle experiments.
-
=== Characterization of Variants Using Fluorescence ===
+
== All other parts submitted ==
-
For each family, we tested the randomers and the designed variants separately. To characterize the promoter strengths, we used RFP as the reporter gene and used a platereader to test for fluorescence during and after induction with IPTG.
+
=== TetR Mutants ===
-
[[File:non_random_dose_response.png|700px]]
+
In addition to our three favourite tetR mutants, we created these four:
-
The six designed T7 promoter variants are named as a function of their predicted promoter efficiency, relative to the wildtype. For example, T7 14 has a predicted efficiency of 14% compared to the consensus T7 promoter, whereas T7 111 is predicted to be 111% more efficient than the wildtype. In the chart above, you find each of the designed promoter variants for both the T7 with and without the lac operator, arranged in increasing predicted efficiency. Contrary to our expectation, some variants that were designed to have a lesser efficiency than the wildtype (e.g. T7 54) seem to have a much higher strength (as measured by fluorescence at saturation, normalized by the optical density). Already in the designed variants, we see a substantial difference in the behavior of the promoters that have a lac operator as opposed to those that do not. The data for this graph was produced in triplicate, so the error bar represents the standard error across those three measurements.  
+
* [http://partsregistry.org/Part:BBa_K613013 K613013] '''V36F mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613014 K613014] '''V36F W43S mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613018 K613018] '''Y42F K108E mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613019 K613019] '''P39Q Y42M mutant'''
-
[[File:induction_ratio.png|700px]]
+
=== T7 Promoter variants ===
-
In addition to fluorescence at saturation, another way to characterize promoter strength is to look at its induction ratio, which is the ratio, at saturation, of fluorescence produced by induction with IPTG versus fluorescence produced without induction. In layman's terms, it indicates how strongly the promoter reacts to induction. Here again, our results indicate that some promoter variants (T7 80 in particular) stand out with respect to this feature. Here too the importance of the lac operator in producing high induction ratios is not to be underestimated. 
+
We submitted a family of T7 promoters with varying strength. Our lysis selection device uses what we refer to as the wild-type (100% reported strength) T7 Promoter:
 +
* [http://partsregistry.org/Part:BBa_K613001 K613001] '''T7 Promoter''', 100% reported strength
 +
In addition, we submitted the following mutants:
-
[[File:varability_comparison.png|200px| left]]
+
Variants without additional lac operator (constitutive):
-
For the three sets of randomers for T7 with and without the lac operator, we tested seventy-two different variants and characterized their expression using the same IPTG induction protocol as with the designed variants. The goal of using these variants was to examine the range of expressions that can be produced by random mutations as opposed to directed mutations. The results, as presented in the graph, indicate that the designed variants (with and without lac operator put together) produce a much higher average normalized fluorescence than the randomers.
+
* [http://partsregistry.org/Part:BBa_K613002 BBa_K613002] '''T7 Promoter''', 14% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613003 BBa_K613003] '''T7 Promoter''', 30% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613004 BBa_K613004] '''T7 Promoter''', 54% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613005 BBa_K613005] '''T7 Promoter''', 80% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613006 BBa_K613006] '''T7 Promoter''', 111% reported strength
-
=== Characterization and DNA Recovery with Lysis ===
+
Variants with additional lac operator (LacI repressed):
-
Since a major component of our scheme for selecting promoters and transcription factors with strong binding affinities required the ability to lyse cells, we also wanted to test a T7-driven lysis cassette.  
+
* [http://partsregistry.org/Part:BBa_K613007 BBa_K613007] '''T7 Promoter, LacI repressed''', 100% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613008 BBa_K613008] '''T7 Promoter, LacI repressed''', 14% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613009 BBa_K613009] '''T7 Promoter, LacI repressed''', 30% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613010 BBa_K613010] '''T7 Promoter, LacI repressed''', 54% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613011 BBa_K613011] '''T7 Promoter, LacI repressed''', 80% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613012 BBa_K613012] '''T7 Promoter, LacI repressed''', 111% reported strength
-
[[File:lysis_dynamics.png|700px]]
+
=== Medium-strength Plac ===
-
 
+
-
Induction with various concentrations of IPTG reveals a stready increase in the amount of lysis that can be obtained. Here 500 uM yields the most substantial amount of lysis, and that concentration was used in all further experiments dealing with lysis. The negative controls were two-fold: one is an unsuccessful attempt at inserting the lysis cassette downstream of a T7 promoter in the psB3K1 plasmid, while the other is a T7 promoter upstream of an RFP gene. Neither should express lysis.
+
-
 
+
-
[[File:dose_response.png|700px]]
+
-
 
+
-
== Other assemblies - without new biobrick ==
+
-
 
+
-
=== J61002 Ptet-RFP ===
+
-
 
+
-
 
+
-
=== Readout system - TetR and RFP ===
+
-
 
+
-
The first readout system is composed of TetR with a constitutive promoter, followed by RFP with a pTet promoter. If TetR '''binds''' to pTet, then RFP is ''' repressed'''. This readout system is convenient for fluorescence detection experiments, but it would not be suited for using the lysis cassette as the reporter gene is being repressed upon TetR-pTet interaction. With the lysis device, the interesting cells (where TetR binds to pTet) would survive and we would recover only the useless TetR mutants.
+
-
 
+
-
[[File:EPFL_Summary_without_LacI.jpg]]
+
-
 
+
-
 
+
-
The plasmids used here are pSB3K1 pConst-TetR and J61002 Ptet-RFP. For more details about them, please go to the "Reporter plasmids" tab
+
-
 
+
-
''ATC induction''
+
-
 
+
-
 
+
-
''Dose-response''
+
-
 
+
-
J61002 only
+
-
 
+
-
=== Readout system - TetR, LacI and RFP ===
+
-
 
+
-
This second readout system is composed of 3 genes: TetR under pConst control, LacI under pTet control (playing the role of an inverter) and finally RFP under pLac control. Here, RFP is '''induced''' when TetR '''binds''' to pTet. Lysis cassette can be put instead of RFP in thy system, having as a consequence that the cells where TetR mutants bind to pTet would lyse.
+
-
 
+
-
[[File:EPFL_Summary_TetR_LacI_RFP.jpg|700px]]
+
-
 
+
-
To get this readout system, we cotransformed pSB3K1 Pconst-TetR Ptet-LacI with J61002 Plac-RFP. Unfortunately, the sequence of Ptet in front of LacI got mutated during the assembly process, resulting in only a partial repression of LacI by TetR. Still, our results do show the effects of TetR and LacI on the whole system. For more details about the plasmids, please refer to the "Reporter plasmids" tab in the "Our project" menu.
+
-
 
+
-
 
+
-
''ATC induction''
+
-
 
+
-
''ATC dose-response curve''
+
-
''IPTG induction''
+
We submitted a new Plac promoter of medium strength. We characterized it with ATC inductions, using RFP as a readout.
 +
* [http://partsregistry.org/Part:BBa_K613000 BBa_K613000] '''pLac promoter''', medium strength
-
''IPTG dose-response curve''
 
{{:Team:EPF-Lausanne/Templates/Footer}}
{{:Team:EPF-Lausanne/Templates/Footer}}

Latest revision as of 22:05, 28 October 2011

Retrieved from "http://2011.igem.org/Team:EPF-Lausanne/Our_Project/Data"