Team:EPF-Lausanne/Our Project/Data

From 2011.igem.org

(Difference between revisions)
(Other assemblies - without new biobrick)
(Summary)
 
(102 intermediate revisions not shown)
Line 1: Line 1:
{{:Team:EPF-Lausanne/Templates/Header|title=Data}}
{{:Team:EPF-Lausanne/Templates/Header|title=Data}}
-
That's how the Data page should look like: https://igem.org/Sample_Data_Page
+
== Overview ==
-
Perhaps we could only provide the link to the Registry page; if we put all the graphs here it's gonna be messy pages (TetR mutants, reporter plasmids and T7 variants)
+
-
We can make a "results" page with all the graphs, or put them in the descript
+
-
== New parts ==
+
=== Summary ===
-
=== TetR Mutants ===
+
[[File:EPFL-Summary_drawing.png|right|thumb|250px]]
-
Lilia, are you also putting the WT into biobrick?
+
-
* V36F
+
Three components constitute our transcription factor development pipeline. The first is a selection system which lyses cells containing strong matches between a mutated transcription factor and its promoter and allows for the speedy recovery of the relevant DNA. The second component is an ''in vivo'' characterization system that uses two different reporter systems as a way to document the binding affinities of the TetR transcription factor and its promoter pTet. The third component is an ''in vitro'' characterization system called MITOMI that allows high-throughput quantitative analysis of DNA-protein interaction strengths.
-
''Sequence''
+
In developing these three pillars, a number of parts were made. We have listed all of them here and have highlighted our favorites.
-
ATGTCCAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTTTCGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCT
+
=== Systems ===
-
* P39K
+
'''Selection System''': We cloned the Berkeley Lysis cassette (BBa_K112808) under control of the T7 promoter into a low copy number plasmid (pSB3K1, formerly BBa_I739202).
-
* Y42F
+
'''In Vivo Characterization''': We cloned an RFP gene under control of T7 promoter variants (parts BBa_K613001 through BBa_K613012) into a low copy number plasmid (pSB3K1, formerly BBa_I739202). We also cloned TetR mutants (parts BBa_K613013 through BBa_K613019) into a  a low copy number plasmid (pSB3K1, formerly BBa_I739202). Both sets of plasmids were thoroughly characterized using IPTG platereader experiments.
-
* P39Q-Y42M
+
'''In Vitro Characterization''': We characterized TetR mutants (parts BBa_K613013, BBa_K613015, BBa_K613016, BBa_K613017, BBa_K613019) in the low copy number plasmid pSB3K1 (formerly BBa_I739202).
-
''Sequence''
+
== Favourite parts ==
-
ATGTCCAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTGTAGAGCAGCAAACAGTGATGTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCT
+
Our three favourite parts are TetR mutants, characterised ''in-vivo'' using our reporter systems, and ''in-vitro'' by MITOMI.
-
== T7 Promoter Variants ==
+
* [http://partsregistry.org/Part:BBa_K613015 BBa_K613015] '''TetR E37A W43S T141A mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613016 BBa_K613016] '''TetR P39K mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613017 BBa_K613017] '''TetR Y42F mutant'''
-
== Other assemblies - without new biobrick ==
+
== Pre-existing parts characterised ==
-
=== J61002 Ptet-RFP ===
+
* [http://partsregistry.org/Part:BBa_K112808:Experience BBa_K112808 Experience Page] - '''The Berkeley Lysis Device''': In developing our Lysis selection device, we characterised induction, and ran proof-of-principle experiments.
 +
== All other parts submitted ==
-
=== Readout system - TetR and RFP ===
+
=== TetR Mutants ===
-
 
+
-
The first readout system is composed of TetR with a constitutive promoter, followed by RFP with a pTet promoter. If TetR '''binds''' to pTet, then RFP is ''' repressed'''. The plasmids used here are pSB3K1 pConst-TetR and J61002 Ptet-RFP. This readout system is convenient for fluorescence detection experiments, but it would not be suited for using the lysis cassette as the reporter gene is being repressed upon TetR-pTet interaction. With the lysis device, the interesting cells (where TetR binds to pTet) would survive and we would recover only the useless TetR mutants.
+
-
 
+
-
[[File:EPFL_Summary_without_LacI.jpg]]
+
-
 
+
-
''ATC induction''
+
In addition to our three favourite tetR mutants, we created these four:
 +
* [http://partsregistry.org/Part:BBa_K613013 K613013] '''V36F mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613014 K613014] '''V36F W43S mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613018 K613018] '''Y42F K108E mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613019 K613019] '''P39Q Y42M mutant'''
-
''Dose-response''
+
=== T7 Promoter variants ===
-
J61002 only
+
We submitted a family of T7 promoters with varying strength. Our lysis selection device uses what we refer to as the wild-type (100% reported strength) T7 Promoter:
 +
* [http://partsregistry.org/Part:BBa_K613001 K613001] '''T7 Promoter''', 100% reported strength
-
=== Readout system - TetR and lysis ===
+
In addition, we submitted the following mutants:
-
This second readout system is composed of 3 genes: TetR under pConst control, LacI under pTet control (playing the role of an inverter) and finally RFP under pLac control. Here, RFP is '''induced''' when TetR '''binds''' to pTet. Lysis cassette can be put instead of RFP in thy system, having as a consequence that the cells where TetR mutants bind to pTet would lyse.
+
Variants without additional lac operator (constitutive):
-
To get this readout system, we cotransformed pSB3K1 Pconst-TetR Ptet-LacI with J61002 Plac-RFP. Unfortunately, the sequence of Ptet in front of LacI got mutated during the assembly process, resulting in only a partial repression of LacI by TetR. Still, our results do show the effects of TetR and LacI on the whole system.
+
* [http://partsregistry.org/Part:BBa_K613002 BBa_K613002] '''T7 Promoter''', 14% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613003 BBa_K613003] '''T7 Promoter''', 30% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613004 BBa_K613004] '''T7 Promoter''', 54% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613005 BBa_K613005] '''T7 Promoter''', 80% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613006 BBa_K613006] '''T7 Promoter''', 111% reported strength
 +
Variants with additional lac operator (LacI repressed):
-
''ATC induction''
+
* [http://partsregistry.org/Part:BBa_K613007 BBa_K613007] '''T7 Promoter, LacI repressed''', 100% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613008 BBa_K613008] '''T7 Promoter, LacI repressed''', 14% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613009 BBa_K613009] '''T7 Promoter, LacI repressed''', 30% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613010 BBa_K613010] '''T7 Promoter, LacI repressed''', 54% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613011 BBa_K613011] '''T7 Promoter, LacI repressed''', 80% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613012 BBa_K613012] '''T7 Promoter, LacI repressed''', 111% reported strength
-
''ATC dose-response curve''
+
=== Medium-strength Plac ===
-
''IPTG induction''
+
We submitted a new Plac promoter of medium strength. We characterized it with ATC inductions, using RFP as a readout.
 +
* [http://partsregistry.org/Part:BBa_K613000 BBa_K613000] '''pLac promoter''', medium strength
-
''IPTG dose-response curve''
 
{{:Team:EPF-Lausanne/Templates/Footer}}
{{:Team:EPF-Lausanne/Templates/Footer}}

Latest revision as of 22:05, 28 October 2011