Team:EPF-Lausanne/Our Project/Data

From 2011.igem.org

(Difference between revisions)
(→pSB3K1 Pconst-TetR)
(→Summary)
 
(119 intermediate revisions not shown)
Line 1: Line 1:
{{:Team:EPF-Lausanne/Templates/Header|title=Data}}
{{:Team:EPF-Lausanne/Templates/Header|title=Data}}
-
== TetR Mutants ==  
+
== Overview ==
-
* V36F
+
=== Summary ===
-
''Sequence''
+
[[File:EPFL-Summary_drawing.png|right|thumb|250px]]
-
ATGTCCAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTTTCGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCT
+
Three components constitute our transcription factor development pipeline. The first is a selection system which lyses cells containing strong matches between a mutated transcription factor and its promoter and allows for the speedy recovery of the relevant DNA. The second component is an ''in vivo'' characterization system that uses two different reporter systems as a way to document the binding affinities of the TetR transcription factor and its promoter pTet. The third component is an ''in vitro'' characterization system called MITOMI that allows high-throughput quantitative analysis of DNA-protein interaction strengths.
-
* P39K
+
In developing these three pillars, a number of parts were made. We have listed all of them here and have highlighted our favorites.
-
* Y42F
+
=== Systems ===
-
* P39Q-Y42M
+
'''Selection System''': We cloned the Berkeley Lysis cassette (BBa_K112808) under control of the T7 promoter into a low copy number plasmid (pSB3K1, formerly BBa_I739202).
-
''Sequence''
+
'''In Vivo Characterization''': We cloned an RFP gene under control of T7 promoter variants (parts BBa_K613001 through BBa_K613012) into a low copy number plasmid (pSB3K1, formerly BBa_I739202). We also cloned TetR mutants (parts BBa_K613013 through BBa_K613019) into a  a low copy number plasmid (pSB3K1, formerly BBa_I739202). Both sets of plasmids were thoroughly characterized using IPTG platereader experiments.
-
ATGTCCAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTGTAGAGCAGCAAACAGTGATGTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCT
+
'''In Vitro Characterization''': We characterized TetR mutants (parts BBa_K613013, BBa_K613015, BBa_K613016, BBa_K613017, BBa_K613019) in the low copy number plasmid pSB3K1 (formerly BBa_I739202).
-
== T7 Promoter Plasmids ==
+
== Favourite parts ==
-
* pSB3K1-T7-const-RFP
+
Our three favourite parts are TetR mutants, characterised ''in-vivo'' using our reporter systems, and ''in-vitro'' by MITOMI.
-
''Description:'' The T7 promoter upstream of the RFP gene, set in the pSB3K1 backbone
+
* [http://partsregistry.org/Part:BBa_K613015 BBa_K613015] '''TetR E37A W43S T141A mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613016 BBa_K613016] '''TetR P39K mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613017 BBa_K613017] '''TetR Y42F mutant'''
-
''Sequence:''
+
== Pre-existing parts characterised ==
-
''Plasmid Map:''
+
* [http://partsregistry.org/Part:BBa_K112808:Experience BBa_K112808 Experience Page] - '''The Berkeley Lysis Device''': In developing our Lysis selection device, we characterised induction, and ran proof-of-principle experiments.
-
''Saturation Curves:''
+
== All other parts submitted ==
-
''Dose-Response Curves:''
+
=== TetR Mutants ===
 +
In addition to our three favourite tetR mutants, we created these four:
-
* pSB3K1-T7-lac-RFP
+
* [http://partsregistry.org/Part:BBa_K613013 K613013] '''V36F mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613014 K613014] '''V36F W43S mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613018 K613018] '''Y42F K108E mutant'''
 +
* [http://partsregistry.org/Part:BBa_K613019 K613019] '''P39Q Y42M mutant'''
 +
=== T7 Promoter variants ===
-
* pSB3K1-T7-lac2-RFP
+
We submitted a family of T7 promoters with varying strength. Our lysis selection device uses what we refer to as the wild-type (100% reported strength) T7 Promoter:
 +
* [http://partsregistry.org/Part:BBa_K613001 K613001] '''T7 Promoter''', 100% reported strength
-
* pSB3K1-T7-const-Lysis
+
In addition, we submitted the following mutants:
 +
Variants without additional lac operator (constitutive):
-
* pSB3K1-T7-lac-Lysis
+
* [http://partsregistry.org/Part:BBa_K613002 BBa_K613002] '''T7 Promoter''', 14% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613003 BBa_K613003] '''T7 Promoter''', 30% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613004 BBa_K613004] '''T7 Promoter''', 54% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613005 BBa_K613005] '''T7 Promoter''', 80% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613006 BBa_K613006] '''T7 Promoter''', 111% reported strength
-
== T7 Promoter Variants ==
+
Variants with additional lac operator (LacI repressed):
-
== Reporter Plasmids ==
+
* [http://partsregistry.org/Part:BBa_K613007 BBa_K613007] '''T7 Promoter, LacI repressed''', 100% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613008 BBa_K613008] '''T7 Promoter, LacI repressed''', 14% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613009 BBa_K613009] '''T7 Promoter, LacI repressed''', 30% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613010 BBa_K613010] '''T7 Promoter, LacI repressed''', 54% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613011 BBa_K613011] '''T7 Promoter, LacI repressed''', 80% reported strength
 +
* [http://partsregistry.org/Part:BBa_K613012 BBa_K613012] '''T7 Promoter, LacI repressed''', 111% reported strength
-
=== J61002 Ptet-RFP ===
+
=== Medium-strength Plac ===
-
== TetR plasmids ==
+
We submitted a new Plac promoter of medium strength. We characterized it with ATC inductions, using RFP as a readout.
 +
* [http://partsregistry.org/Part:BBa_K613000 BBa_K613000] '''pLac promoter''', medium strength
-
=== pSB3K1 Pconst-TetR ===
 
-
 
-
''Description''
 
-
 
-
This plasmid is the intermediary  step before having the complete TetR plasmid. Here we only added TetR under constitutive promoter, wanting to add LacI under Ptet afterwards with a second Gibson. See the "assembly" page for more details.
 
-
 
-
 
-
Parts assembled:
 
-
* Plasmid backbone: pSB3K1 from ETHZ 2007 [http://partsregistry.org/wiki/index.php?title=Part:pSB3K1 "pSB3K1"] (taken from the delivery plate)
 
-
* Pconst: J23116 from Berkeley 2006 [http://partsregistry.org/Part:BBa_J23116 "j23116"] (sequence copied into our primers)
 
-
* RBS (B0034?) and spacer: (sequence copied into our primers)
 
-
* TetR: [https://static.igem.org/mediawiki/2011/b/b0/EPFL_TetR_sequence.txt "TetR sequence"] (623 bp) The sequence lacks a stop codon, we added TAA with our primers
 
-
 
-
 
-
''Sequence''
 
-
 
-
Complete sequence of the plasmid: [https://static.igem.org/mediawiki/2011/5/5a/EPFL_PSB3K1_Pconst-TetR.txt "pSb3K1 Pconst-TetR"]
 
-
 
-
Do we really need this?
 
-
Sequencing data compared to the sequence of Pconst,RBS+spacer and TetR gene:[https://static.igem.org/mediawiki/2011/2/23/EPFL_pSb3K1_TetR_seq.txt "pSb3K1_TetR_seq"]
 
-
All these parts are correct.
 
-
 
-
 
-
''Plasmid map''
 
-
 
-
This plasmid contains a p15A replication origin as well as a Kanamycin resistance marker.
 
-
 
-
[[File:EPFL_Tetr_plasmid.jpg‎|300px]]
 
-
 
-
 
-
''ATC induction''
 
-
 
-
The platereader experiment was run for 12h, using 0-0.1-5-25-200-300-800-1000-1200-1500 nM/ul final concentrations of ATC. The cells were cotransformed with pSB3K1 Pconst-TetR and J61002 Ptet-RFP, to use the fluorescent protein as a readout for TetR inactivation by ATC. All the concentrations were tested on 4 different cultures, shown in the next graphs:
 
-
 
-
[[File:EPFL_pSB_TetR_J6_Ptet_RFP_col1.jpg|200px]]
 
-
[[File:EPFL_pSB_TetR_J6_Ptet_RFP_col2.jpg|200px]]
 
-
[[File:EPFL_pSB_TetR_J6_Ptet_RFP_col3.jpg|200px]]
 
-
[[File:EPFL_pSB_TetR_J6_Ptet_RFP_col4.jpg|200px]]
 
-
 
-
''Dose-response''
 
-
 
-
These data are coming from the same experiment; they show the saturation value of RFP expression for each ATC concentration. The values were averaged over the 4 different cell cultures.
 
-
 
-
[[File:EPFL_pSB_TetR_J6_Ptet_RFP_dose-resp.jpg]]
 
-
 
-
=== pSB3K1 Pconst-TetR Ptet-LacI ===
 
-
 
-
 
-
''Description''
 
-
 
-
This is the final TetR plasmid, containing the TetR gene as well as the LacI inverter with a Ptet promoter. Here we have wild-type TetR and Ptet sequences, but this plasmid is also intended to be used with mutant TetR genes and mutant Ptet binding sequences.
 
-
 
-
 
-
Parts assembled
 
-
* Plasmid backbone containing Pconst and TetR: see precedent section
 
-
* Terminator: B0014 from the Registry [http://partsregistry.org/Part:BBa_B0014 "B0014"] (sequence copied into our primers)
 
-
* Ptet: R0040 from Registry [http://partsregistry.org/Part:BBa_R0040 "R0040"] (sequence copied into our primers)
 
-
* LacI: amplified from Repressilator plasmid [https://static.igem.org/mediawiki/2011/7/7f/EPFL_LacI_sequence.txt "LacI sequence"] The sequence lacks a stop codon, we added TAA with our primers.
 
-
 
-
 
-
''Sequence''
 
-
Add results for TetR sequencing
 
-
Add results for LacI asap
 
-
 
-
 
-
''Plasmid map''
 
-
 
-
This plasmid has the same structure as pSB3K1 Pconst-TetR: p15A replication origin and Kanamycin resistance marker. However, Ptet-LacI has been added after the p15A sequence.
 
-
 
-
[[File:EPFL_TetR_plasmid_with_LacI.jpg‎|300px]]
 
-
 
-
''ATC induction''
 
-
 
-
''ATC dose-response curve''
 
-
 
-
''IPTG induction''
 
-
 
-
''IPTG dose-response curve''
 
{{:Team:EPF-Lausanne/Templates/Footer}}
{{:Team:EPF-Lausanne/Templates/Footer}}

Latest revision as of 22:05, 28 October 2011

Retrieved from "http://2011.igem.org/Team:EPF-Lausanne/Our_Project/Data"