|
|
| Line 4: |
Line 4: |
| | = Data = | | = Data = |
| | | | |
| - | == rrnB P1 promoter ==
| |
| - |
| |
| - | [[File: Primer_rrnBL_060711_resultat.JPG|thumb|PCR products from rrnB P1 BioBrick separated on 1.5 % agarose. The marked products represent rrnB P1 with regular pre/sufix]]
| |
| - |
| |
| - | The rrnB P1 promoter is negatively regulated by ppGpp [Kilde] and therefore sutible for our stress sensor.
| |
| - | We found the
| |
| - | promoter in the registry distribution (BBa_K112118) submitted by Berkly in 2008.
| |
| - |
| |
| - | This part is in the BBb standard form [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard]
| |
| - | and is not compatible with the parts in the BBa standard. In order to get the part in BBa standard we
| |
| - | PCR amplified the promoter using the BBa_K112118 as template and primers containing the BBa prefix and suffix:
| |
| - |
| |
| - | [[File: Test_rrnB_C3_060811_wiki.jpg|thumb|rrnB P1 promoter in the psb1C3 plasmid]]
| |
| - |
| |
| - |
| |
| - | {| border="1"
| |
| - | |-
| |
| - | !Primer
| |
| - | !Type
| |
| - | !Sequence
| |
| - | |-
| |
| - | |rrnB P1 F
| |
| - | |Forward
| |
| - | |GTTTCTTCGAATTCGCGGCCGCTTCTAGAGACGTATCCTACGCCCGTGGT
| |
| - | |-
| |
| - | |rrnB P1 R
| |
| - | |Reverse
| |
| - | |GTTTCTTCCTGCAGCGGCCGCTACTAGTACGCCTTCCCGCTACAGAGTCA
| |
| - | |-
| |
| - | |}
| |
| - |
| |
| - | The PCR-product was run on a 1,5% agarose gel in order to verify that we had achieved the correct product and to separate it from any other unwanted products.
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - | The new rrnB P1 biobrick was inserted in the psb1C3 plasmid provided by the iGem HQ.
| |
| - | Plasmid from five colonies were digested with the enzymes BstBI and SpeI
| |
| - | It seems like parallel 1 and 2 have the insert.
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - |
| |
| - | == Stress Sensor ==
| |
| - |
| |
| - | [[File: Super_BB__minus_p1_1-5-2.jpg|thumb|Five parallels digested with… ]]
| |
| - |
| |
| - | The stress sensor consist of MCherry (a RFP gene) controlled by the Lac promoter and the Lac inhibitor (LacI) controlled by the rrnB P1 promoter.
| |
| - | The MCherry biobrick (BBa_J06702) is complete with both RBS and a terminator sequence, and we fist connected this part with the LacP biobrick BBa_R0011.
| |
| - | The LacI biobrick BBa_C0012 had a RBS region but no terminator, so we added the term biobrick BBa_B0015.
| |
| - | Then we connected these to constructs to get the final stress sensor minus the P1 promoter.
| |
| - | In order the check if the construct was correct we digested the plasmid with ........
| |
| - |
| |
| - | [[File:construct_map_1807.jpg|thumb|Plasmid map of the complete construct. Promoters are shown in blue, and genes as inside arrows. Only single restriction sites are shown.]]
| |
| - |
| |
| - | Then we added the P1 promoter using the PCR-product as insert. To check if the part was inserted we digested the resulting plasmids with BstBI cutting in the promoter region.
| |
| | | | |
| | | | |
"
