Team:KIT-Kyoto/Notebook/LabNote/GFPMLF8

From 2011.igem.org

(Difference between revisions)
(Created page with "{{Template:KIT-Kyoto/Notebook}} {{Template:KIT-Kyoto/menu1}} <BR> <div id=NAKAMI> {| style="color:#000080;background-color:transparent;" cellpadding="3" cellspacing="1" border=...")
 
(4 intermediate revisions not shown)
Line 9: Line 9:
!align="right"|Language:[[Team:KIT-Kyoto/Notebook/LabNote/GFPMLF8|English]]/[[Team:KIT-Kyoto/Notebook/LabNote/GFPMLF8J|Japanese]]
!align="right"|Language:[[Team:KIT-Kyoto/Notebook/LabNote/GFPMLF8|English]]/[[Team:KIT-Kyoto/Notebook/LabNote/GFPMLF8J|Japanese]]
|}
|}
 +
 +
==''22nd, August''==
 +
<b>Members</b>
 +
<br>
 +
:Yoshimura, Nakagawa, Matsunami
 +
<br>
 +
:We have transformed ''E. coli DH5 alpha'' with the plasmid BBa_E0240.
 +
<br>
 +
<b>Results</b>
 +
:The transformed bacterial colonies were obtained.
 +
<br>
 +
 +
==''23rd, August''==
 +
<b>Members</b>
 +
<br>
 +
:Yoshimura, Nakagawa
 +
<br>
 +
:1. Pre-culture of bacteria transformed with BBa_E0240.<br>
 +
:2. Design of primers to construct GFP plasmid without ATG from the plasmid BBa_E0240.<br>
 +
<br>
 +
<b>Results</b>
 +
:1. We have succeeded the preculture.
 +
:2. The designed primers are shown below.
 +
::F: 3' TT<span style="COLOR: red">GAATTC</span>TT<span style="COLOR: red">TCTAGA</span>TTCGTAAAGGAGAAGAA<br>
 +
            <em>Eco</em>RⅠ   <em>Xba</em>Ⅰ<br>
 +
::Tmvalue:67.75°C  33 base<br>
 +
<br>
 +
::R: 5' AAA<font color="#ff0000">CTGCAG</font>AAA<font color="#ff0000">ACTAGT</font>TTTTTATTATTTGTATAG<br>
 +
              <em>Pst</em>Ⅰ   <em>Spe</em>Ⅰ<br>
 +
::Tmvalue:67.66°C  36 base
 +
<BR>
 +
 +
==''24th, August''==
 +
<b>Members</b>
 +
<br>
 +
:Yoshimura、Nakagawa
 +
<br>
 +
:After isolation of plasmid DNA BBa_E0240 by the alkaline-lysis method, DNA samples were digested by the following restriction enzymes at 37 ℃ for 30 min.
 +
 +
:<table border=1 width="220px">
 +
:<tr><td width="130px" align=center>ddH<sub>2</sub>O</td><td width="90px"  align=right>2 µl</td></tr>
 +
:<tr><td align=center>BBa_E0240</td><td align=right>50 µl</td></tr>
 +
:<tr><td align=center><em>Eco</em>RⅠ</td><td align=right>1 µl</td></tr>
 +
:<tr><td align=center><em>Pst</em>Ⅰ</td><td align=right>1 µl</td></tr>
 +
:<tr><td align=center>10 x H Buffer</td><td align=right>6 µl</td></tr>
 +
:<tr><td align=center>&nbsp;</td><td align=right>total 60 µl</td></tr>
 +
:</table>
 +
<br>
 +
:After restriction enzyme digestion, samples were electrophoresed in 1% agarose gel at 100 V for 30min.
 +
<br>
 +
<b>Results</b>
 +
:DNA bands in the agarose gel.<BR>
 +
:<html><body>
 +
<IMG src="https://static.igem.org/mediawiki/2011/3/30/2011.08.24_%E3%83%99%E3%82%AF%E3%82%BF%E3%83%BC.JPG" width="250px" height="250px" border="0">
 +
</body></html>
 +
<br>
 +
:You can see DNA band at around 800bp.
 +
<BR>
 +
 +
==''25th, August''==
 +
<b>Members</b>
 +
<br>
 +
:Yoshimura、Nakagawa<br>
 +
<br>
 +
:PCR reaction was carried out by using primers designed on 23rd. The reaction conditions are summarized below.
 +
 +
:<table border="0"><tr><td>
 +
:<table border="0" width="150px">
 +
:<tr><td align=center>PCR reaction</td></tr>
 +
:</table>
 +
:<table border=1 width="250px">
 +
:<tr><td width="150px" align=center>10 µM GFP Primer F</td><td width="100px"  align=right>1.5 µl</td></tr>
 +
:<tr><td align=center>10 µM GFP Primer R</td><td align=right>1.5 µl</td></tr>
 +
:<tr><td align=center>BBa_E0240</td><td align=right>1 µl</td></tr>
 +
:<tr><td align=center>10 x PCR Buffer for KOD Plus</td><td align=right>5 µl</td></tr>
 +
:<tr><td align=center>dNTPs</td><td align=right>4 µl</td></tr>
 +
:<tr><td align=center>MgSO<sub>4</sub></td><td align=right>4 µl</td></tr>
 +
:<tr><td align=center>ddH<sub>2</sub>O</td><td align=right>32 µl</td></tr>
 +
:<tr><td align=center>KOD Plus</td><td align=right>1 µl</td></tr>
 +
:<tr><td>&nbsp;</td><td align=right>total 50 µl</td></tr>
 +
:</table>
 +
:</td><TD></TD><TD></TD><td>
 +
:<table border="0" width="100px">
 +
:<tr><td align=center>Cycle条件</td></tr>
 +
:</table>
 +
:<table border=1 width="400px">
 +
:<tr><td width="100px" align=center>Pre-Denature</td><td width="100px" align=center>95°C</td><td width="100px" align=center>30sec</td><td width="100px">&nbsp;</td></tr>
 +
:<tr><td align=center>Denature</td><td align=center>95°C</td><td align=center>30sec</td><td align=center rowspan=3>30 Cycle</td></tr>
 +
:<tr><td align=center>Anneling</td><td align=center>50°C</td><td align=center>1min</td></tr>
 +
:<tr><td align=center>Extension</td><td align=center>68°C</td><td align=center>1min</td></tr>
 +
:<tr><td align=center>End</td><td align=center>4°C</td><td align=center>keep</td><td width="100px">&nbsp;</td></tr>
 +
:</table>
 +
:</td></tr>
 +
:</table>
 +
 +
:Agarose gel electrophoresis was carried out to detect the PCR products.
 +
:Then the PCR products were digested with the following restriction enzymes (at 37°C for 16 hours).
 +
 +
:<table border=1 width="220px">
 +
:<tr><td width="130px" align=center>ddH<sub>2</sub>O</td><td width="90px"  align=right>2 µl</td></tr>
 +
:<tr><td align=center>BBa_E0240</td><td align=right>50 µl</td></tr>
 +
:<tr><td align=center><em>Eco</em>RⅠ</td><td align=right>1 µl</td></tr>
 +
:<tr><td align=center><em>Pst</em>Ⅰ</td><td align=right>1 µl</td></tr>
 +
:<tr><td align=center>10 x H Buffer</td><td align=right>6 µl</td></tr>
 +
:<tr><td align=center>&nbsp;</td><td align=right>total 60 µl</td></tr>
 +
:</table>
 +
<br>
 +
<b>Results</b>
 +
:DNA bands in the agarose gel.<BR>
 +
:<html><body>
 +
<IMG src="https://static.igem.org/mediawiki/2011/1/16/2011.08.25_GFP.JPG" width="250px" height="250px" border="0">
 +
</body></html>
 +
<br>
 +
:You can see DNA band at around 800bp.
 +
<br>
 +
 +
==''26th, August''==
 +
<b>Member</b>
 +
<br>
 +
:Nakagawa<br>
 +
<br>
 +
:1.Extraction of DNA from the agarose gel.
 +
:2.Transformation of ''E. coli DH5 alpha'' with the plasmid pSB1C3.
 +
<br>
 +
<b>Results</b>
 +
:1. Picture of agarose gel after cutting out of the portion containing the DNA fragment.<BR>
 +
:<html><body>
 +
<IMG src="https://static.igem.org/mediawiki/2011/c/ce/8.26GFP%E3%82%B2%E3%83%AB%E6%8A%BD.jpg" width="250px" height="250px" border="0">
 +
</body></html>
 +
<br>
 +
:Final concentration of the isolated DNA was 510 ng/µl.
 +
<br>
 +
:2. Although small colonies were observed, we decided to transform the bacteria again just in case.
 +
<br>
 +
 +
==''27th, August''==
 +
<b>Member</b>
 +
<br>
 +
:Yoshimura
 +
<br>
 +
:Transformation of ''E. coli DH5'' alpha with the plasmid pSB1C3
 +
<br>
 +
<b>Results</b>
 +
:The transformed bacterial colonies were obtained.
 +
<br>
 +
 +
==''29th, August''==
 +
<b>Member</b>
 +
<br>
 +
:Yoshimura, Nakagawa
 +
<br>
 +
:Pre-culture of pSB1C3(6 sample)
 +
<br>
 +
<b>Results</b>
 +
:We have succeeded to grow bacteria from three samples out of six.
 +
<br>
 +
 +
==''30th, August''==
 +
<b>Member</b>
 +
<br>
 +
:Nakagawa<br>
 +
<br>
 +
:1.Pre-culture of pSB1C3(6 sample)
 +
:2.Design of primers to construct GFP plasmid without ATG from the plasmid BBa_E0240.
 +
<br>
 +
<b>Results</b>
 +
:1.We have succeeded the preculture.
 +
:2.The designed primers are shown below.
 +
::F: 3' TT<span style="COLOR: red">GAATTC</span>TTT<span style="COLOR: red">TCTAGA</span>TTTCGTAAAGGAGAAGAA<br>
 +
            <em>Eco</em>RⅠ     <em>Xba</em>Ⅰ<br>
 +
::Tm value :68.8゜C  35 base<br>
 +
<br>
 +
 +
==''31st, August''==
 +
<b>Member</b>
 +
<br>
 +
:Nakagawa<br>
 +
<br>
 +
:After isolation of pSB1C3 by the alkaline-lysis methodfollowed by phenol-chloroform treatment, DNA was digested with the following restriction enzymes (30 min at 37℃).
 +
 +
:<table border=1 width="220px">
 +
:<tr><td width="130px" align=center>ddH<sub>2</sub>O</td><td width="90px"  align=right>2 µl</td></tr>
 +
:<tr><td align=center>BBa_E0240</td><td align=right>50 µl</td></tr>
 +
:<tr><td align=center><em>Eco</em>RⅠ</td><td align=right>1 µl</td></tr>
 +
:<tr><td align=center><em>Pst</em>Ⅰ</td><td align=right>1 µl</td></tr>
 +
:<tr><td align=center>10 x H Buffer</td><td align=right>6 µl</td></tr>
 +
:<tr><td align=center>&nbsp;</td><td align=right>total 60 µl</td></tr>
 +
:</table>
 +
<br>
 +
:After restriction enzyme digestion, DNA samples were electrophoresed at 100 V for 30min.
 +
 +
<br>
 +
<b>Results</b>
 +
:Image of the agarose gel.<BR>
 +
:<html><body>
 +
<IMG src="https://static.igem.org/mediawiki/2011/f/f2/2011.08.31.JPG" width="250px" height="250px" border="0">
 +
</body></html>
 +
 +
 +
</div>
</div>

Latest revision as of 03:40, 6 October 2011



Home Team Project Parts Notebook Safety Human Practice Attributions


Home > Notebook > Lab Note > August Language:English/Japanese

22nd, August

Members

Yoshimura, Nakagawa, Matsunami


We have transformed E. coli DH5 alpha with the plasmid BBa_E0240.


Results

The transformed bacterial colonies were obtained.


23rd, August

Members

Yoshimura, Nakagawa


1. Pre-culture of bacteria transformed with BBa_E0240.
2. Design of primers to construct GFP plasmid without ATG from the plasmid BBa_E0240.


Results

1. We have succeeded the preculture.
2. The designed primers are shown below.
F: 3' TTGAATTCTTTCTAGATTCGTAAAGGAGAAGAA

         EcoRⅠ   Xba

Tmvalue:67.75°C  33 base


R: 5' AAACTGCAGAAAACTAGTTTTTTATTATTTGTATAG

           PstⅠ   Spe

Tmvalue:67.66°C  36 base


24th, August

Members

Yoshimura、Nakagawa


After isolation of plasmid DNA BBa_E0240 by the alkaline-lysis method, DNA samples were digested by the following restriction enzymes at 37 ℃ for 30 min.
ddH2O2 µl
BBa_E024050 µl
EcoRⅠ1 µl
Pst1 µl
10 x H Buffer6 µl
 total 60 µl


After restriction enzyme digestion, samples were electrophoresed in 1% agarose gel at 100 V for 30min.


Results

DNA bands in the agarose gel.


You can see DNA band at around 800bp.


25th, August

Members

Yoshimura、Nakagawa


PCR reaction was carried out by using primers designed on 23rd. The reaction conditions are summarized below.
PCR reaction
10 µM GFP Primer F1.5 µl
10 µM GFP Primer R1.5 µl
BBa_E02401 µl
10 x PCR Buffer for KOD Plus5 µl
dNTPs4 µl
MgSO44 µl
ddH2O32 µl
KOD Plus1 µl
 total 50 µl
Cycle条件
Pre-Denature95°C30sec 
Denature95°C30sec30 Cycle
Anneling50°C1min
Extension68°C1min
End4°Ckeep 
Agarose gel electrophoresis was carried out to detect the PCR products.
Then the PCR products were digested with the following restriction enzymes (at 37°C for 16 hours).
ddH2O2 µl
BBa_E024050 µl
EcoRⅠ1 µl
Pst1 µl
10 x H Buffer6 µl
 total 60 µl


Results

DNA bands in the agarose gel.


You can see DNA band at around 800bp.


26th, August

Member

Nakagawa


1.Extraction of DNA from the agarose gel.
2.Transformation of E. coli DH5 alpha with the plasmid pSB1C3.


Results

1. Picture of agarose gel after cutting out of the portion containing the DNA fragment.


Final concentration of the isolated DNA was 510 ng/µl.


2. Although small colonies were observed, we decided to transform the bacteria again just in case.


27th, August

Member

Yoshimura


Transformation of E. coli DH5 alpha with the plasmid pSB1C3


Results

The transformed bacterial colonies were obtained.


29th, August

Member

Yoshimura, Nakagawa


Pre-culture of pSB1C3(6 sample)


Results

We have succeeded to grow bacteria from three samples out of six.


30th, August

Member

Nakagawa


1.Pre-culture of pSB1C3(6 sample)
2.Design of primers to construct GFP plasmid without ATG from the plasmid BBa_E0240.


Results

1.We have succeeded the preculture.
2.The designed primers are shown below.
F: 3' TTGAATTCTTTTCTAGATTTCGTAAAGGAGAAGAA

         EcoRⅠ    Xba

Tm value :68.8゜C  35 base


31st, August

Member

Nakagawa


After isolation of pSB1C3 by the alkaline-lysis methodfollowed by phenol-chloroform treatment, DNA was digested with the following restriction enzymes (30 min at 37℃).
ddH2O2 µl
BBa_E024050 µl
EcoRⅠ1 µl
Pst1 µl
10 x H Buffer6 µl
 total 60 µl


After restriction enzyme digestion, DNA samples were electrophoresed at 100 V for 30min.


Results

Image of the agarose gel.