Team:Tokyo Metropolitan/Project/Killing

From 2011.igem.org

(Difference between revisions)

Latest revision as of 02:18, 6 October 2011

Killing Device

Concept

When bee attack enemy, they sting needle and inject toxin. In Japan, the most cause of death from animal is attacted from bee (especially wasp).Bee is awful animal but taking a hint from it, we propose new system for killing bacteria using conjugation.

Conjugation

Fig1.Conjugation[1]

E.coli has sex. “Male” E.coli (having conjugative plasmid) mate other “Female“ E.coli(not having conjugative plasmid). Male E.coli transfer conjugative plasmid to Female E.coli. Then, after conjugation, Female E.coli gets conjugative plasmid and change sex “male”.
Conjugation is useful system for killing bacteria. We plan to integrate killing gene (below-mentioned) into the conjugative plasmid and induce this plasmid into E.coli. Then E.coli conjugate other E.coli and send killing gene which induce E.coli to cell lysis when it expressed.

Cell Lysis

Bacteriophage have cell lysis cassette S,R,Rz called "Holin-Endolysin". S gene encodes "Holin" that forming hole on　inner membrane of host cell.R gene encodes "Endolysin" degradates murein in intermediate membrane of host cell(in membrane of host cell,not harmful).Rz is also know for the enzyme attack outer membrane with R gene.
Using this system, we cannot only kill target bacteria which are conjugated but also be harmless for other organism.

Fig.2 Cell Lysis[2]

Anti-killer device

To prevent cell lysis of BeE.coli itself, anti-killing device is needed. We chose pTet-TetR system for repressing expression of Killing gene. TetR bind tet operator (TetO) and inhibit expression of tetracycline resistance gene. But in existence tetracycline, TetR formed complex with tetracycline and lost ability of binding tetO.

Then tetracycline resistance gene expressed. aTc (Anhydrotetracycline) is known as analog of tetracycline so aTc bind TetR like tetracycline and inhibit TetR to binding tetO.
Ptet-TetR system is appropriate Anti-killer Device. In BeE.coli, TetR is expressed constitutively and repressed expression of killing gene. But killing gene has sent to other bacteria which doesn’t have tetR. Then conjugated bacteria cell lysis. In addition, from point of view of biosafety, to add aTc induce BeE.coli to cell lysis.

Figure3: TetR is transcription regulator[3]

Figure4: Killing Concept

Parts Design

Killing Device
BBa_K543016

Anti-killing Device
BBa_K543015

Result

Repress expression of GFP by Anti-killing device

We confirm whether Anti-killing Device is working or not. We transform Anti-killing Device into E.coli which have GFP generator(I13522:Ptet-B0034-GFP-B0015) and observe its florescence. Figure2 is a result of this experiment. Left is E.coli transformed Anti-killing Device, right is control. Although not perfectly repressed GFP expression, we confirmed Anti-killing Device is working. Figure5 is difference of GFP florescence by comparing with absorbance of 525nm. For perfectly repressed expression cording under Ptet, RBS is needed to be more strong(ex.B0034).In addition, we should do more experience to get quantitative date.

Figure5: repress expression of GFP by Anti-killing device

Sequence analysis
We check sequence of P0440(B0034-C0040-B0010-B0012).But sequence of C0040 was incorrect. Sequence of P0440 is here.

Device assay
We propose a new assay of killing with conjugation.
⇒Click to see description.

Reference

[1]University of Birmingham, Horizontal gene transfer (HGT) in biofilms (http://www.birmingham.ac.uk/schools/biosciences/staff/profile.aspx?ReferenceId=6059)
[2]Ry Young, Ing-Nang Wang and William D. Roof. Phages will out: strategies of host cell lysis Trends in microbiology, 2000 Elsevier
[3]Maria A. Schumacher, Marshall C. Miller, Steve Grkovic, Melissa H. Brown, Ronald A. Skurray and Richard G. Brennan. 2002 Structural basis for cooperative DNA binding by two dimers of the multidrug-binding protein QacR

@@ Line 2: / Line 2: @@
 <html>
 <div style="width: 800px; margin-left: 70px; padding-top: 25px; padding-left: 20px;">
-</html>
+</html><html><div align="center"><table><tr height="50"><td width="260"><a href="https://2011.igem.org/Team:Tokyo_Metropolitan/Project/SpeedUp"><img src="https://static.igem.org/mediawiki/2011/2/2a/Tokyo_Metropolitan_projectSs.jpg"></a></td>
+<td width="260"><a href="https://2011.igem.org/Team:Tokyo_Metropolitan/Project/Targeting"><img src="https://static.igem.org/mediawiki/2011/8/83/Tokyo_Metropolitan_projectTs.jpg"></a></td>
+<td width="260"><a href="https://2011.igem.org/Team:Tokyo_Metropolitan/Project/Killing"><img src="https://static.igem.org/mediawiki/2011/6/6b/Tokyo_Metropolitan_projectKs.jpg"></a></td>
+</tr></table></div></html><br>
 <html>
 <table>
 <tr><td width="800">
 <font size="5"><b>Killing Device</b></font>
-<hr><br>
+<br><br>
-<font size="5">Concept</font><br>
+<font size="5">Concept</font><hr>
 When bee attack enemy, they sting needle and inject toxin. In Japan, the most cause of death from animal is attacted from bee (especially wasp).Bee is awful animal but taking a hint from it, we propose new system for killing bacteria using conjugation.<br><br>
 </td></tr>
 <tr><td><u><b><font size="3">Conjugation</font></b></u><br>
-E.coli has sex. “Male” E.coli (having conjugative plasmid) mate other “Female“ E.coli(not having conjugative plasmid). Male E.coli transfer conjugative plasmid to Female E.coli. Then, after conjugation, Female E.coli gets conjugative plasmid and change sex “male”.
+<table><tr><td width="300" align="center"><img src="https://static.igem.org/mediawiki/2011/5/55/Tokyo_Metropolitan_conjugation.jpg" width="250"><br>Fig1.Conjugation[1]</td><td width="500">E.coli has sex. “Male” E.coli (having conjugative plasmid) mate other “Female“ E.coli(not having conjugative plasmid). Male E.coli transfer conjugative plasmid to Female E.coli. Then, after conjugation, Female E.coli gets conjugative plasmid and change sex “male”.
+<br>
+Conjugation is useful system for killing bacteria. We plan to integrate killing gene (below-mentioned) into the conjugative plasmid and induce this plasmid into E.coli. Then E.coli conjugate other E.coli and send killing gene which induce E.coli to cell lysis when it expressed.</td></tr></table>
 <br>
-Conjugation is useful system for killing bacteria. We plan to integrate killing gene (below-mentioned) into the conjugative plasmid and induce this plasmid into E.coli. Then E.coli conjugate other E.coli and send killing gene which induce E.coli to cell lysis when it expressed.
-<br><br>
 </td></tr>
 <tr><td><u><b><font size="3">Cell Lysis</font></b></u><br>
-<table><tr><td colspan="2">
+<table><tr valign="top"><td width="500">
-Bacteriophage have cell lysis cassette Holin-Endolysin. Holin forms hole on outer membrane of host cell.</td></tr><tr valign="top"><td width="400">Endolysin is degradation peptide glycan in intermediate membrane of host cell.</td><td><img src="https://static.igem.org/mediawiki/2011/f/f1/Tokyo_Metropolitan_Lysis.jpg" width="400"><br><div align="center">Figure2 Bacteriophage Lysis Casstte</div></td></tr></table>
+Bacteriophage have cell lysis cassette S,R,Rz called "Holin-Endolysin". S gene encodes "Holin" that forming hole on　inner membrane of host cell.R gene encodes "Endolysin" degradates murein in intermediate membrane of host cell(in membrane of host cell,not harmful).Rz is also know for the enzyme attack outer membrane with R gene.<br>
+Using this system, we cannot only kill target bacteria which are conjugated but also be harmless for other organism.<br><br>
+</td><td width="300"><div align="center"><img src="https://static.igem.org/mediawiki/2011/b/b8/Tokyo_Metropolitan_holin-endolysin.jpg" width="250"><br>Fig.2 Cell Lysis[2]</div></td></tr></table>
 </td></tr>
 <tr><td><u><b><font size="3">Anti-killer device</font></b></u><br>
 <table><tr><td colspan="2">
 To prevent cell lysis of BeE.coli itself, anti-killing device is needed. We chose pTet-TetR system for repressing expression of Killing gene. TetR bind tet operator (TetO) and inhibit expression of tetracycline resistance gene. But in existence tetracycline, TetR formed complex with tetracycline and lost ability of binding tetO. <br></td></tr><tr><td width="400">Then tetracycline resistance gene expressed. aTc (Anhydrotetracycline) is known as analog of tetracycline so aTc bind TetR like tetracycline and inhibit TetR to binding tetO. <br>
 Ptet-TetR system is appropriate Anti-killer Device. In BeE.coli, TetR is expressed constitutively and repressed expression of killing gene. But killing gene has sent to other bacteria which doesn’t have tetR. Then conjugated bacteria cell lysis. In addition, from point of view of biosafety, to add aTc induce BeE.coli to cell lysis.</td><td width="400"><img src="https://static.igem.org/mediawiki/2011/e/ee/Tokyo_Metropolitan_Anti-killer.png" width="398"><br>
-<div align="center">Figure3: TetR is transcription regulator</div></td></tr></table>
+<div align="center">Figure3: TetR is transcription regulator[3]</div></td></tr></table>
 <br>
 </td></tr>
 <tr><td colspan="2"><img src="https://static.igem.org/mediawiki/2011/8/84/Tokyo_Metropolitan_Killing1.png" width="800"><br>
-<div align="center">Figure4: Killing Concept</div></td></tr>
+<div align="center">Figure4: Killing Concept</div><br><br></td></tr>
-</table>
+<tr><td>
+<font size="5">Parts Design</font><hr><div align="center">
+<table><tr><td width="360" align="left">
+<font size="3"><b>Killing Device</b></font><br>
+<font size="3">BBa_K543016</font><br>
+<img src="https://static.igem.org/mediawiki/2011/0/0a/Tokyo_Metropolitan_K543016.png"><br></td>
+<td width="360" align="left">
+<font size="3"><b>Anti-killing Device</b></font><br>
+<font size="3">BBa_K543015</font><br>
+<img src="https://static.igem.org/mediawiki/2011/9/9b/Tokyo_Metropolitan_K543015.png">
+<br></td></tr></table></div><br>
+</td></tr>
+<tr><td>
+<font size="5">Result</font><hr>
+<font size="3"><b>Repress expression of GFP by Anti-killing device</b></font><br>
+<table>
+<tr><td width="500">
+We confirm whether Anti-killing Device is working or not. We transform Anti-killing Device into E.coli which have GFP generator(I13522:Ptet-B0034-GFP-B0015) and observe its florescence. Figure2 is a result of this experiment. Left is E.coli transformed Anti-killing Device, right is control. Although not perfectly repressed GFP expression, we confirmed Anti-killing Device is working. Figure5 is difference of GFP florescence by comparing with absorbance of 525nm.
+For perfectly repressed expression cording under Ptet, RBS is needed to be more strong(ex.B0034).In addition, we should do more experience to get quantitative date.
+</td><td width="300"><img src="https://static.igem.org/mediawiki/2011/c/cd/Tokyo_Metropolitan_Killing2.png" width="300"><br><div align="center">Figure5: repress expression of GFP by Anti-killing device</div></td></tr>
+</table>
+<font size="3"><b>Sequence analysis</b></font><br>
+We check sequence of P0440(B0034-C0040-B0010-B0012).But sequence of C0040 was incorrect.
+Sequence of P0440 is here.
-</td></tr></table>
+<br><br>
+<br>
+<font size="3"><b>Device assay</b></font><br>
+We propose a new assay of killing with conjugation.<br>
+<a href="https://2011.igem.org/Team:Tokyo_Metropolitan/Project/Visualization">⇒Click to see description.</a>
+<br><br><br>
+<font size="5">Reference</font><hr>
+[1]University of Birmingham, Horizontal gene transfer (HGT) in biofilms (http://www.birmingham.ac.uk/schools/biosciences/staff/profile.aspx?ReferenceId=6059)<br>
+[2]Ry Young, Ing-Nang Wang and William D. Roof. Phages will out: strategies of host
+cell lysis Trends in microbiology, 2000 Elsevier<br>
+[3]Maria A. Schumacher, Marshall C. Miller, Steve Grkovic, Melissa H. Brown, Ronald A. Skurray and Richard G. Brennan. 2002 Structural basis for cooperative DNA binding by two dimers of the multidrug-binding protein QacR<br>
+</td></tr></table>
-</p>
-<script src='http://partsregistry.org/cgi/partsdb/seq_edit/all.js'></script> <DIV id='sequencePaneDiv'> <INPUT type='hidden' id='new_dna_format' name='new_dna_format' value='' /> <INPUT type='hidden' id='selection_start' name='selection_start' value='14' /> <INPUT type='hidden' id='selection_end'   name='selection_end'   value='0' /></DIV> <script> var sequence = new String('cctctggtgactttatccgtaaataatttaacccactccacaaaaaggctcaacaggttggtggttctcaccaccaaaagcaccacaccccacgcaaaaacaagtttttgctgatttttctttataaatagagtgttatgaaaaattagtttctcttactctctttatgatatttaaaaaagcggtgtcggcgcggctacaacaacgcgccgacaccgttttgtaggggtggtactgactatttttataaaaaacattattttatattaggggtgctgctagcggcgcggtgtgtttttttataggataccgctaggggcgctgctagcggtgcgtccctgtttgcattatgaattactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtcacacaggaaagtactagatgccagaaaaacatgacctgttggccgccattctcgcggcaaaggaacaaggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggcagatataatggcggtgcgtttacaaaaacagtaatcgacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttctcgacttcgccggactaagtagcaatctcgcttatataacgagcgtgtttatcggctacatcggtactgactcgattggttcgcttatcaaacgcttcgctgctaaaaaagccggagtagaagatggtagaaatcaataaatggtagaaatcaataatcaacgtaaggcgttcctcgatatgctggcgtggtcggagggaactgataacggacgtcagaaaaccagaaatcatggttatgacgtcattgtaggcggagagctatttactgattactccgatcaccctcgcaaacttgtcacgctaaacccaaaactcaaatcaacaggcgccggacgctaccagcttctttcccgttggtgggatgcctaccgcaagcagcttggcctgaaagacttctctccgaaaagtcaggacgctgtggcattgcagcagattaaggagcgtggcgctttacctatgattgatcgtggtgatatccgtcaggcaatcgaccgttgcagcaatatctgggcttcactgccgggcgctggttatggtcagttcgagcataaggctgacagcctgattgcaaaattcaaagaagcgggcggaacggtcagagagattgatgtatgaatgagcagagtcaccgcgattatctccgctctggttatctgcatcatcgtctgcctgtcatgggctgttaatcattaccgtgataacgccattacctacaaagcccagcgcgacaaaaatgccagagaactgaagctggcgaacgcggcaattactgacatgcagatgcgtcagcgtgatgttgctgcgctcgatgcaaaatacacgaaggagttagctgatgctaaagctgaaaatgatgctctgcgtgatgatgttgccgctggtcgtcgtcggttgcacatcaaagcagtctgtcagtcagtgcgtgaagccaccaccgcctccggcgtggataatgcagcctccccccgactggcagacaccgctgaacgggattatttcaccctcagagagaggctgatcactatgcaaaaacaactggaaggaacccagaagtatattaatgagcagtgcagatagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata');        var seqFeatures = new Array( ['brick',445,1701,'K124017', 1], ['brick',1,355,'I714030', 1], ['brick',1710,1838,'B0015', 1], ['brick',1710,1789,'B0010', 0], ['brick',364,417,'R0040', 0], ['brick',1798,1838,'B0012', 0], ['brick',426,438,'B0032', 0], ['stop',1831,1831,'Stop', 0], ['reg',383,388,'-35', 0], ['reg',406,411,'-10', 0], ['rbs',426,438,'RBS-3\Weak', 0], ['rbs',432,435,'RBS', 0], ['wiggle',364,382,'TetR 1', 0], ['wiggle',389,407,'TetR 2', 0], ['h_pin',1721,1764,'', 0], ['h_pin',1805,1824,'T7 TE', 0], ['polya',1825,1838,'PolyA', 0]); var subParts = new Array (  new Part (10028, 'I714030', '', 'http://partsregistry.org/images/partbypart/icon_conjugation.png'),  new Part (187, 'R0040', 'p(tetR)', 'http://partsregistry.org/images/partbypart/icon_regulatory.png'),  new Part (149, 'B0032', '', 'http://partsregistry.org/images/partbypart/icon_rbs.png'),  new Part (12888, 'K124017', '', 'http://partsregistry.org/images/partbypart/icon_coding.png'),  new Part (603, 'B0010', '', 'http://partsregistry.org/images/partbypart/icon_terminator.png'),  new Part (145, 'B0012', '', 'http://partsregistry.org/images/partbypart/icon_terminator.png')); var Format = '_subparts_'; var PrimaryPartID = '23723'; var Selection_Start = 0; var Selection_End = 0; showSeqFeatures(false);  </script><div style='position:relative;clear:both;width:100%'><div style=''>
 </html>