Team:NTNU Trondheim/Data

From 2011.igem.org

(Difference between revisions)
(→Data)
 
(47 intermediate revisions not shown)
Line 4: Line 4:
= Data =
= Data =
-
== rrnB P1 promoter ==
 
-
The rrnB P1 promoter is negatively regulated by ppGpp [Kilde]. We found the
+
==Our System==
-
promoter in the registry distribution (BBa_K112118) submitted by Berkly in 2008.
+
[[File:NTNU2011 system.png|center|]]
-
This part is in the BBb standard form [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard]
+
==Our favorite new parts==
-
and is not compatible with the parts in the BBa standard. In order to get the part in BBa standard we
+
-
PCR amplified the promoter using the BBa_K112118 as template and primers containing the BBa prefix and suffix:
+
-
{| border="1"
+
#[http://partsregistry.org/Part:BBa_K639003 Parts registry] - '''Stress sensor, BBa_K639003.''' The complete fluorescent stress sensor construct.
-
|-
+
#[http://partsregistry.org/Part:BBa_K639000 Parts registry] - '''Stress sensor precursor, BBa_K639000.''' This brick will yield red colonies as it is. When a promoter is inserted in front of the brick, the red color will disappear or be weaker, due to production of LacI that repress lac-promoter.
-
!Primer
+
#[http://partsregistry.org/Part:BBa_K639002 Parts registry] - '''rrnB, BBa_K639002.''' rrnB P1 promoter with standard prefix and suffix in BBa format.
-
!Type
+
-
!Sequence
+
-
|-
+
-
|rrnB P1 F
+
-
|Forward
+
-
|GTTTCTTCGAATTCGCGGCCGCTTCTAGAGACGTATCCTACGCCCGTGGT
+
-
|-
+
-
|rrnB P1 R
+
-
|Reverse
+
-
|GTTTCTTCCTGCAGCGGCCGCTACTAGTACGCCTTCCCGCTACAGAGTCA
+
-
|-
+
-
|}
+
-
The PCR-product was run on a 1,5% agarose gel in order to verify that we had achieved the correct product and to separate it from any other unwanted products.
+
==Characterization of Pre-existing Parts==
-
[[File: Primer_rrnBL_060711_resultat.JPG|thumb|PCR products from rrnB P1 BioBrick separated on 1.5 % agarose. The marked products represent rrnB P1 with regular pre/sufix]]
+
#[http://partsregistry.org/Part:BBa_K112118:Experience Parts registry] - '''rrnB P1, BBa_K112118.''' rrnB P1 promoter BioBrick in BBb format made by the Berkley iGEM team in 2008.
-
 
+
#[http://partsregistry.org/Part:BBa_K292006:Experience#User_Reviews Parts registry] - '''LacI repressor, BBa_K292006.''' LacI repressor that SupBiotech-Paris iGEM team made in 2009.
-
The new rrnB P1 biobrick was inserted in the psb1C3 plasmid provided by the iGem HQ.  
+
-
Plasmid from five colonies were digested with the enzymes ....... and .............. giving the lengths ........... and ................ if the promoter was inserted.
+
-
 
+
-
[[File: Test_rrnB_C3_060811_wiki.jpg|thumb|PCR products from rrnB P1 BioBrick separated on 1.5 % agarose. The marked products represent rrnB P1 with regular pre/sufix]]
+
-
 
+
-
It seems like parallel 1 and 2 have the insert.  
+
 +
==Other parts==
 +
#[http://partsregistry.org/Part:BBa_K639001 Parts registry] - '''relA, BBa_K639001.''' relA codes for ppGpp synthase, which has been shown to be useful for regulating the rrnB P1 promoter, mimicking the stringent response when overexpressed.
{{:Team:NTNU_Trondheim/NTNU_footer}}
{{:Team:NTNU_Trondheim/NTNU_footer}}

Latest revision as of 07:37, 21 September 2011



Data

Our System

NTNU2011 system.png

Our favorite new parts

  1. [http://partsregistry.org/Part:BBa_K639003 Parts registry] - Stress sensor, BBa_K639003. The complete fluorescent stress sensor construct.
  2. [http://partsregistry.org/Part:BBa_K639000 Parts registry] - Stress sensor precursor, BBa_K639000. This brick will yield red colonies as it is. When a promoter is inserted in front of the brick, the red color will disappear or be weaker, due to production of LacI that repress lac-promoter.
  3. [http://partsregistry.org/Part:BBa_K639002 Parts registry] - rrnB, BBa_K639002. rrnB P1 promoter with standard prefix and suffix in BBa format.

Characterization of Pre-existing Parts

  1. [http://partsregistry.org/Part:BBa_K112118:Experience Parts registry] - rrnB P1, BBa_K112118. rrnB P1 promoter BioBrick in BBb format made by the Berkley iGEM team in 2008.
  2. [http://partsregistry.org/Part:BBa_K292006:Experience#User_Reviews Parts registry] - LacI repressor, BBa_K292006. LacI repressor that SupBiotech-Paris iGEM team made in 2009.

Other parts

  1. [http://partsregistry.org/Part:BBa_K639001 Parts registry] - relA, BBa_K639001. relA codes for ppGpp synthase, which has been shown to be useful for regulating the rrnB P1 promoter, mimicking the stringent response when overexpressed.


Retrieved from "http://2011.igem.org/Team:NTNU_Trondheim/Data"