Team:EPF-Lausanne/Our Project/T7 promoter variants

From 2011.igem.org

(Difference between revisions)
(DNA Recovery with Lysis)
(The different variants)
Line 23: Line 23:
=== The different variants ===
=== The different variants ===
-
Vdog, please explain the different variants here :) They should only be listed on the data page, and it's trange to talk about them here without really showing them
+
{|
 +
!Strength
 +
!Mutation
 +
!Biobrick Sequence
 +
|-
 +
| Wildtype
 +
| None
 +
| TAATACGACTCACTATAGGGAGA
 +
|}
=== Characterization with RFP ===
=== Characterization with RFP ===

Revision as of 18:44, 19 September 2011