Team:Washington/Primers

From 2011.igem.org

(Difference between revisions)
(Created page with "{{Template:Team:Washington/Templates/Top}} =EVERYONE PLEASE ENTER AND FILL OUT THE TABLE= For info on [http://en.wikipedia.org/wiki/Help:Table#Sorting Wiki Tables] ==EXAMPL...")
m
 
(14 intermediate revisions not shown)
Line 1: Line 1:
{{Template:Team:Washington/Templates/Top}}
{{Template:Team:Washington/Templates/Top}}
-
 
+
__NOTOC__
-
 
+
-
=EVERYONE PLEASE ENTER AND FILL OUT THE TABLE=
+
-
 
+
For info on [http://en.wikipedia.org/wiki/Help:Table#Sorting Wiki Tables]
For info on [http://en.wikipedia.org/wiki/Help:Table#Sorting Wiki Tables]
-
==EXAMPLE TABLE (DO NOT MODIFY)==
+
=PCR Conditions and Primers of Registry Parts=
-
{| class="wikitable sortable collapsible" border="1"
+
Please fill out for every PCR reaction done on a registry part (both new and old).
-
|+ Sortable and collapsible table
+
 
 +
{| class="wikitable sortable collapsible" border="1" cellpadding="2" style="text-align: center; width: 200px;"
 +
|+'''PCR Conditions and Primers of Registry Parts'''
|-
|-
-
! scope="col" | Alphabetic
+
! scope="col" | Amplification Success<br>(S, M, N)
-
! scope="col" | Numeric
+
! scope="col"  width="150pt" | Template Part #
-
! scope="col" | Date
+
! scope="col"  width="100pt" | Template Form<br> (M, C, P)
-
! scope="col" class="unsortable" | Unsortable
+
! scope="col"  width="100pt" | Template Source
 +
! scope="col"  class="unsortable" | Forward Primer Name
 +
! scope="col"  class="unsortable" | Reverse Primer Name
 +
! scope="col"  width="100pt" | Annealing Temperature<br> (Celsius)
 +
! scope="col" | Extension Time <br>(seconds)
 +
! scope="col" | Percent DMSO
 +
! scope="col" | Polymerase Used
 +
! scope="col"  width="100pt" | Forward Primer<br> (5'->3')
 +
! scope="col"  width="100pt" | Reverse Primer <br>(5'->3')
 +
! scope="col" class="unsortable" | Additional Notes
|-
|-
-
| d || 20 || 2008-11-24 || This
+
| S || BBa_XYZ001 || M || Synthesized Gene || EX_Decarb_F || RedDecarb_SP_2 || 60 || 30 || 0 || Phusion || GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA || CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG || Original reverse primer was missing extra nucleotides at end, so amplification worked, cloning didn't
|-
|-
-
| b || 8 || 2004-03-01 || column
+
 
 +
| S || ### ||M || Gene from Collaborator || KumaCloning-F || KumaCloning-R || 66 || 60 || 0 || Phusion || GTTTCTTCGAATTCGCGGCCG || GTTTCTTTCCTGCAGCGGCCGG || These primers amplify the Kumamolisin gene, adding standard BioBrick ends for cloning.
|-
|-
-
| a || 6 || 1979-07-23 || cannot
+
 
-
|-
+
| Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill
-
| c || 4.2 || 1492-12-08 || be
+
|-
|-
-
| e || 0 || 1601-08-13 || sorted.
 
|}
|}
-
==TABLE TO BE FILLED OUT==
+
==LEGEND==
-
LEGEND:
+
*Amplification Success (S, M, N): Was the amplification successful. 
 +
**S = Single Band at Desired Size
 +
**M = Multiple Bands, but one at desired length
 +
**N = No band at desired length
*Template Part #:  The Registry Number of the Part being amplified from
*Template Part #:  The Registry Number of the Part being amplified from
*Template Form:  The source form of the template DNA
*Template Form:  The source form of the template DNA
Line 43: Line 53:
*Percent DMSO:  Was DMSO added, if not 0, if so at what %
*Percent DMSO:  Was DMSO added, if not 0, if so at what %
*Polymerase Used:  Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc)
*Polymerase Used:  Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc)
-
*Amplification Success (S, M, N):  Was the amplification successful. 
 
-
**S = Single Band at Desired Size
 
-
**M = Multiple Bands, but one at desired length
 
-
**N = No band at desired length
 
*Primer Name:  The name of the primer ordered
*Primer Name:  The name of the primer ordered
*Additional Notes:  Any additional relevant information
*Additional Notes:  Any additional relevant information
 +
==Tool==
-
{| class="wikitable sortable collapsible" border="1" cellpadding="2"
+
[http://excel2wiki.net/index.php Excel to wiki format tool]
 +
 
 +
Recreate the table exactly in excel and fill in with data
 +
 
 +
Copy the all the data (no header) into the box
 +
 
 +
Copy the code starting with the line that looks like |- do not copy header stop copying at |- as well
 +
 
 +
Paste into this page's code in the blank line above the |fill|fill| etc line
 +
 
 +
 
 +
=EXAMPLE TABLE (DO NOT MODIFY)=
 +
{| class="wikitable sortable collapsible" border="1"
 +
|+ Sortable and collapsible table
|-
|-
-
! scope="col"  width="100pt" | Template Part #
+
! scope="col" | Alphabetic
-
! scope="col"  width="100pt" | Template Form (M, C, P)
+
! scope="col" | Numeric
-
! scope="col"  width="100pt" | Template Source
+
! scope="col" | Date
-
! scope="col"  width="100pt" | Forward Primer (5'->3')
+
! scope="col" class="unsortable" | Unsortable
-
! scope="col"  width="100pt" | Reverse Primer (5'->3')
+
-
! scope="col"  width="100pt" | Annealing Temperature (Celsius)
+
-
! scope="col" | Extension Time (seconds)
+
-
! scope="col" | Percent DMSO
+
-
! scope="col" | Polymerase Used
+
-
! scope="col" | Amplification Success (S, M, N)
+
-
! scope="col"  class="unsortable" | Forward Primer Name
+
-
! scope="col"  class="unsortable" | Reverse Primer Name
+
-
! scope="col" class="unsortable" | Additional Notes
+
|-
|-
-
| TBD || M || Synthesized Gene || GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA || CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG || 60 || 30 || 0 || Phusion || S || EX_Decarb_F || RedDecarb_SP_2 || Original reverse primer was missing extra nucleotides at end, so amplification worked, cloning didn't
+
| d || 20 || 2008-11-24 || This
|-
|-
-
| Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill || Fill
+
| b || 8 || 2004-03-01 || column
|-
|-
 +
| a || 6 || 1979-07-23 || cannot
 +
|-
 +
| c || 4.2 || 1492-12-08 || be
 +
|-
 +
| e || 0 || 1601-08-13 || sorted.
|}
|}

Latest revision as of 20:24, 15 September 2011


For info on [http://en.wikipedia.org/wiki/Help:Table#Sorting Wiki Tables]


PCR Conditions and Primers of Registry Parts

Please fill out for every PCR reaction done on a registry part (both new and old).

PCR Conditions and Primers of Registry Parts
Amplification Success
(S, M, N) 		Template Part # Template Form
(M, C, P) 		Template Source Forward Primer Name Reverse Primer Name Annealing Temperature
(Celsius) 		Extension Time
(seconds) 		Percent DMSO Polymerase Used Forward Primer
(5'->3') 		Reverse Primer
(5'->3') 		Additional Notes
S BBa_XYZ001 M Synthesized Gene EX_Decarb_F RedDecarb_SP_2 60 30 0 Phusion GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG Original reverse primer was missing extra nucleotides at end, so amplification worked, cloning didn't
S ### M Gene from Collaborator KumaCloning-F KumaCloning-R 66 60 0 Phusion GTTTCTTCGAATTCGCGGCCG GTTTCTTTCCTGCAGCGGCCGG These primers amplify the Kumamolisin gene, adding standard BioBrick ends for cloning.
Fill Fill Fill Fill Fill Fill Fill Fill Fill Fill Fill Fill Fill


LEGEND

  • Amplification Success (S, M, N): Was the amplification successful.
    • S = Single Band at Desired Size
    • M = Multiple Bands, but one at desired length
    • N = No band at desired length
  • Template Part #: The Registry Number of the Part being amplified from
  • Template Form: The source form of the template DNA
    • Miniprep (M)
    • Colony (C)
    • PCR Product (P)
  • Template Source: Where the template is originally from, such as 2011 Parts Kits, Synthesized Gene, Genomic, etc
  • Forward Primer (5'->3'): Full sequence of the Forward primer used
  • Reverse Primer (5'->3'): Full sequence of the Reverse primer used
  • Annealing Temperature (Celsius): The annealing temperature used in the PCR reaction
  • Extension Time (seconds): The extension time used in the PCR reaction
  • Percent DMSO: Was DMSO added, if not 0, if so at what %
  • Polymerase Used: Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc)
  • Primer Name: The name of the primer ordered
  • Additional Notes: Any additional relevant information


Tool

[http://excel2wiki.net/index.php Excel to wiki format tool]

Recreate the table exactly in excel and fill in with data

Copy the all the data (no header) into the box

Copy the code starting with the line that looks like |- do not copy header stop copying at |- as well

Paste into this page's code in the blank line above the |fill|fill| etc line


EXAMPLE TABLE (DO NOT MODIFY)

Sortable and collapsible table
Alphabetic Numeric Date Unsortable
d 20 2008-11-24 This
b 8 2004-03-01 column
a 6 1979-07-23 cannot
c 4.2 1492-12-08 be
e 0 1601-08-13 sorted.
Retrieved from "http://2011.igem.org/Team:Washington/Primers"