Revision as of 21:20, 13 September 2011

For info on [http://en.wikipedia.org/wiki/Help:Table#Sorting Wiki Tables]

PCR Conditions and Primers of Registry Parts

Please fill out for every PCR reaction done on a registry part (both new and old).

**PCR Conditions and Primers of Registry Parts**
Amplification Success (S, M, N)	Template Part #	Template Form (M, C, P)	Template Source	Forward Primer Name	Reverse Primer Name	Annealing Temperature (Celsius)	Extension Time (seconds)	Percent DMSO	Polymerase Used	Forward Primer (5'->3')	Reverse Primer (5'->3')	Additional Notes
S	BBa_XYZ001	M	Synthesized Gene	EX_Decarb_F	RedDecarb_SP_2	60	30	0	Phusion	GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA	CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG	Original reverse primer was missing extra nucleotides at end, so amplification worked, cloning didn't
Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill	Fill

Amplification Success (S, M, N): Was the amplification successful.
- S = Single Band at Desired Size
- M = Multiple Bands, but one at desired length
- N = No band at desired length
Template Part #: The Registry Number of the Part being amplified from
Template Form: The source form of the template DNA
- Miniprep (M)
- Colony (C)
- PCR Product (P)
Template Source: Where the template is originally from, such as 2011 Parts Kits, Synthesized Gene, Genomic, etc
Forward Primer (5'->3'): Full sequence of the Forward primer used
Reverse Primer (5'->3'): Full sequence of the Reverse primer used
Annealing Temperature (Celsius): The annealing temperature used in the PCR reaction
Extension Time (seconds): The extension time used in the PCR reaction
Percent DMSO: Was DMSO added, if not 0, if so at what %
Polymerase Used: Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc)
Primer Name: The name of the primer ordered
Additional Notes: Any additional relevant information

[http://excel2wiki.net/index.php Excel to wiki format tool]

Recreate the table exactly in excel and fill in with data

Copy the all the data (no header) into the box

Copy the code starting with the line that looks like |- do not copy header stop copying at |- as well

Paste into this page's code

Sortable and collapsible table
Alphabetic	Numeric	Date	Unsortable
d	20	2008-11-24	This
b	8	2004-03-01	column
a	6	1979-07-23	cannot
c	4.2	1492-12-08	be
e	0	1601-08-13	sorted.

@@ Line 60: / Line 60: @@
 Paste into this page's code
+* there is a big comment where you should paste the code
 =EXAMPLE TABLE (DO NOT MODIFY)=