Team:Washington/Primers

From 2011.igem.org

(Difference between revisions)
(Tool)
(Tool)
Line 60: Line 60:
Paste into this page's code
Paste into this page's code
 +
 +
* there is a big comment where you should paste the code
=EXAMPLE TABLE (DO NOT MODIFY)=
=EXAMPLE TABLE (DO NOT MODIFY)=

Revision as of 21:20, 13 September 2011

For info on [http://en.wikipedia.org/wiki/Help:Table#Sorting Wiki Tables]

Contents

PCR Conditions and Primers of Registry Parts

Please fill out for every PCR reaction done on a registry part (both new and old).

PCR Conditions and Primers of Registry Parts
Amplification Success
(S, M, N)
Template Part # Template Form
(M, C, P)
Template Source Forward Primer Name Reverse Primer Name Annealing Temperature
(Celsius)
Extension Time
(seconds)
Percent DMSO Polymerase Used Forward Primer
(5'->3')
Reverse Primer
(5'->3')
Additional Notes
S BBa_XYZ001 M Synthesized Gene EX_Decarb_F RedDecarb_SP_2 60 30 0 Phusion GTTTCTTCGAATTCGCGGCCGCTTCTAGATGCCGCAGCTGGAA CCAATGCATTGGTTCTGCAGCGGCCGCTACTAGTATCAGTGGTGGTGGTG Original reverse primer was missing extra nucleotides at end, so amplification worked, cloning didn't
Fill Fill Fill Fill Fill Fill Fill Fill Fill Fill Fill Fill Fill

LEGEND

  • Amplification Success (S, M, N): Was the amplification successful.
    • S = Single Band at Desired Size
    • M = Multiple Bands, but one at desired length
    • N = No band at desired length
  • Template Part #: The Registry Number of the Part being amplified from
  • Template Form: The source form of the template DNA
    • Miniprep (M)
    • Colony (C)
    • PCR Product (P)
  • Template Source: Where the template is originally from, such as 2011 Parts Kits, Synthesized Gene, Genomic, etc
  • Forward Primer (5'->3'): Full sequence of the Forward primer used
  • Reverse Primer (5'->3'): Full sequence of the Reverse primer used
  • Annealing Temperature (Celsius): The annealing temperature used in the PCR reaction
  • Extension Time (seconds): The extension time used in the PCR reaction
  • Percent DMSO: Was DMSO added, if not 0, if so at what %
  • Polymerase Used: Which polymerase enzyme was used (e.g. Phusion, Taq, Vent, Pfu, etc)
  • Primer Name: The name of the primer ordered
  • Additional Notes: Any additional relevant information

Tool

[http://excel2wiki.net/index.php Excel to wiki format tool]

Recreate the table exactly in excel and fill in with data

Copy the all the data (no header) into the box

Copy the code starting with the line that looks like |- do not copy header stop copying at |- as well

Paste into this page's code

  • there is a big comment where you should paste the code

EXAMPLE TABLE (DO NOT MODIFY)

Sortable and collapsible table
Alphabetic Numeric Date Unsortable
d 20 2008-11-24 This
b 8 2004-03-01 column
a 6 1979-07-23 cannot
c 4.2 1492-12-08 be
e 0 1601-08-13 sorted.