"
Team:NTNU Trondheim/relA
From 2011.igem.org
(→relA) |
(→relA) |
||
| Line 17: | Line 17: | ||
The gene was amplified from colony PCR, digested and inserted into digested linearized pSB1A3. The sequence of the gene + pre- and suffix is given in the textfile. | The gene was amplified from colony PCR, digested and inserted into digested linearized pSB1A3. The sequence of the gene + pre- and suffix is given in the textfile. | ||
| - | [[File:relABioBrick.txt | + | [[File:relABioBrick.txt Sequence RelA biobrick]] |
Revision as of 15:38, 25 August 2011
relA
In a previous study(1) the possible fuction of rrnB P1 in a biological containment system was investigated. ppGpp synthase (relA) was over-expressed to investigate the effect on the promoter. They showed that the expression was completely turned off when high amounts of relA was produced (1). relA synthesizes ppGpp when an "empty" amino-acyl t-RNA binds the ribosome. However when it is over-expressed, ppGpp is produced at sufficient levels to inhibit rrnB P1.
We wanted to use relA to characterize ppGpp's effect on the rrnB P1 promoter. To use relA in our project, we had to amplify the gene from chromosomal DNA, as it was not found in the Partsregistry. Primers were designed as shown below, giving the full 2234 bp gene plus the Openwetware prefix and suffix;
relA.fwd: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGATGGTTGCGGTAAGAAGTGCACA
relA.rev: GTTTCTTCCTGCAGCGGCCGCTACTAGTACTAACTCCCGTGCAACCGACG
The gene was amplified from colony PCR, digested and inserted into digested linearized pSB1A3. The sequence of the gene + pre- and suffix is given in the textfile.
File:RelABioBrick.txt Sequence RelA biobrick
NOTE: The gene contains a PstI site at bp 1393-1398. This could be removed with site-specific point mutagenesis, changing CTGCAG → CTACAG or CTGCAA. In our project, we avoided this problem by doing partial digestion in those steps where plasmids containing RelA had to be cut with PstI.
