Team:NTNU Trondheim/Data

From 2011.igem.org

(Difference between revisions)
(Data)
(Stress Sensor)
Line 62: Line 62:
== Stress Sensor ==
== Stress Sensor ==
 +
 +
[[File: Super_BB__minus_p1_1-5-2.jpg|thumb|Five parallels digested with… ]]
The stress sensor consist of MCherry (a RFP gene) controlled by the Lac promoter and the Lac inhibitor (LacI) controlled by the rrnB P1 promoter.  
The stress sensor consist of MCherry (a RFP gene) controlled by the Lac promoter and the Lac inhibitor (LacI) controlled by the rrnB P1 promoter.  
Line 69: Line 71:
In order the check if the construct was correct we digested the plasmid with ........   
In order the check if the construct was correct we digested the plasmid with ........   
-
[[File: Super_BB__minus_p1_1-5-2.jpg|thumb|Five parallels digested with… ]]
+
[[File:construct_map_1807.jpg|thumb|Plasmid map of the complete construct. Promoters are shown in blue, and genes as inside arrows. Only single restriction sites are shown.]]
Then we added the P1 promoter using the PCR-product as insert. To check if the part was inserted we digested the resulting plasmids with BstBI cutting in the promoter region.  
Then we added the P1 promoter using the PCR-product as insert. To check if the part was inserted we digested the resulting plasmids with BstBI cutting in the promoter region.  
-
[[File:construct_map_1807.jpg|thumb|Plasmid map of the complete construct. Promoters are shown in blue, and genes as inside arrows. Only single restriction sites are shown.]]
 
{{:Team:NTNU_Trondheim/NTNU_footer}}
{{:Team:NTNU_Trondheim/NTNU_footer}}

Revision as of 07:37, 24 August 2011



Data

rrnB P1 promoter

PCR products from rrnB P1 BioBrick separated on 1.5 % agarose. The marked products represent rrnB P1 with regular pre/sufix

The rrnB P1 promoter is negatively regulated by ppGpp [Kilde] and therefore sutible for our stress sensor. We found the promoter in the registry distribution (BBa_K112118) submitted by Berkly in 2008.

This part is in the BBb standard form [1] and is not compatible with the parts in the BBa standard. In order to get the part in BBa standard we PCR amplified the promoter using the BBa_K112118 as template and primers containing the BBa prefix and suffix:

rrnB P1 promoter in the psb1C3 plasmid


Primer Type Sequence
rrnB P1 F Forward GTTTCTTCGAATTCGCGGCCGCTTCTAGAGACGTATCCTACGCCCGTGGT
rrnB P1 R Reverse GTTTCTTCCTGCAGCGGCCGCTACTAGTACGCCTTCCCGCTACAGAGTCA

The PCR-product was run on a 1,5% agarose gel in order to verify that we had achieved the correct product and to separate it from any other unwanted products.







The new rrnB P1 biobrick was inserted in the psb1C3 plasmid provided by the iGem HQ. Plasmid from five colonies were digested with the enzymes BstBI and SpeI It seems like parallel 1 and 2 have the insert.





Stress Sensor

Five parallels digested with…

The stress sensor consist of MCherry (a RFP gene) controlled by the Lac promoter and the Lac inhibitor (LacI) controlled by the rrnB P1 promoter. The MCherry biobrick (BBa_J06702) is complete with both RBS and a terminator sequence, and we fist connected this part with the LacP biobrick BBa_R0011. The LacI biobrick BBa_C0012 had a RBS region but no terminator, so we added the term biobrick BBa_B0015. Then we connected these to constructs to get the final stress sensor minus the P1 promoter. In order the check if the construct was correct we digested the plasmid with ........

Plasmid map of the complete construct. Promoters are shown in blue, and genes as inside arrows. Only single restriction sites are shown.

Then we added the P1 promoter using the PCR-product as insert. To check if the part was inserted we digested the resulting plasmids with BstBI cutting in the promoter region.