Team:Harvard/Notebook

From 2011.igem.org

(Difference between revisions)

Latest revision as of 23:06, 25 October 2011

bar

**September**
Sun	Mon	Tue	Wed	Thu	Fri	Sat

				1	2	3
4	5	6	7	8	9	10
11	12	13	14	15	16	17
18	19	20	21	22	23	24
25	26	27	28	29	30	31

June 28th

Sequencing:

the following samples from 6/27 were sent to Genewiz for sequencing:
- PyrF F, R (one sample with PyrF_F, one with PyrF_R)
- rpoz F, R (one sample with rpoz_F, one with rpoz_R)

Lambda red results:

the colonies on the plates did not look promising, and the ones we chose and grew up in LB+kan did not actually grow. Just to be certain, we choose 18 more colonies: 6 from 37.5µL arabinose 100µL plated, 6 from 3.75µL arabinose 100µL plated, and 6 from 37.5µL arabinose 1.5mL plated. Three from each plate were grown in plain LB and three with kan. We will let it grow in 30˚C, overnight if necessary, and hopefully see bacteria for PCR.
Assuming this does not work, we prepared more ∆HisB∆PyrF∆rpoZ+pKD46 in two ways: we put 3 colonies in LB+amp from the 6/16 transformation plate, and we streaked a new amp plate from the glycerol stock
Another possibility is that something is wrong with our lambda red. We designed primers to verify that the pKD46 plasmid is really in the cells.

Kan-ZFB-wp-his3-ura3 construct:

Our last few PCR purifications have given us very low yields, and consequently we have had to use large amounts of our DNA (and the large amounts of buffer salts may also be why our lambda red recombinations have failed). When we tried to amplify our current DNA using the hisura-kan_F and ZFB-wp-hisura_R primers and the Phusion mastermix, it did not work (see 6/23). We will try to gain more product in two ways:

1) Repeat 6/23 PCR but use KAPA mastermix

the KAPA mix may work better than the Phusion.
Used KAPA protocol with 1µL of kan-ZFB overlap as template, hisura-kan_F and ZFB-wp-hisura_R primers, 65˚C annealing temp, 90 sec elongation time
made 2 reactions

2) Repeat overlap extension PCR (see 6/16) with KAPA mastermix

used KAPA protocol with 1µL kan cassette and 1µL of ZFB-wp-hisura, 65˚C annealing temp, 90 sec elongation
10 cycles without primers; hisura-kan_F and ZFB-wp-hisura_R primers added; 15 more cycles
made 6 reactions

E gel to check reactions worked: all 6 overlap PCRs successful, but not the other two reactions.

kan-ZFB-wp-hisura construct 6/28/11

combined samples 1-3 and 4-6 and ran on 1% agarose gel for extraction

kan-ZFB-wp-hisura construct for gel extraction 6/28/11

used Qiagen gel extraction kit and instructions with the following modifications:
- gel bands were dissolved in 500µL of buffer QG regardless of the gel volume
- gel heated at 50C for 20 min (to make up for reduced amount of buffer QG)
- after melting, 10µL of NaOAC (3M) were added to adjust the pH
- DNA from samples 1-3 were eluted in 20µL of ddH2O; DNA from samples 4-6 were eluted in 20µL of buffer EB
- water sample: 273.4 ng/µL, 260/280=1.92
- EB sample: 136.9 ng/µL, 260/280=2.38

June 28th - Bioinformatics

Attention all Harvard iGEM-ers!!! According to the iGEM Main Page, our preliminary project descriptions and safety proposals are due on July 15. Please see the aforementioned link so we can get this done ASAP- we don't want to miss any deadlines and have all our hard work wasted!

Finalized our Positive Control Sequences, using Justin's macro to insert the F1 helices into the appropriate zif268 F2 backbone

Length of chip oligos: 131-140bp (based on Cut Site Design)
- Primers: 20bp (x2= 40bp)
- zif268 F2 backbone + helix= 23aa (x3=69bp; some fingers ~3aa longer)
- Some alternate backbones are longer than zif268 F2 backbone
- Type II binding/cut sites= 11bp on each side (22bp total)
- Standard legnth: 40 + 69 + 22 = 131bp

Use WebLogos as a final visual check of our final generated sequences

Plasmid and Oligo Design Schematics

Oligo Design

Expression Plasmid Design

Chip-Based Sequence Design Schematic

Chip-based process for sequence design, taken from Kosuri, et al. 2010 model of scalable gene synthesis Kosuri2010

References

Kosuri2010 pmid=21113165

</biblio>

Harvard Logo

Running the Generator!

File:HARVFasta total.csv NOTE: LATER GENERATED NEW SEQUENCES. NOT UP TO DATE.

Generated Final Chip Sequences

We ran the generator once earlier this afternoon, but had to re-run it again due to a typo in the cut sites and the number of sequences we desired for each backbone. Luckily, we caught these errors, and after checking the program once again, we ran it a final time this afternoon.
- It took about 45 minutes for the program to generate and reverse translate the 54900 sequences.
- During this time, we created a function that will re-translate the sequences that the generator output. It compares the original helix with the re-translated helix to make sure that our reverse-translate works properly.
  - This step went smoothly, and we verified that the sequences were reverse-translated properly.
- To make sure that the distributions generated were as expected, we made WebLogos of the helices generated(see below).
The output file (in the Dropbox: iGem > chip > final chip.csv) originally had the following headers: 'Target', 'Backbone #', 'Helix Sequence', 'Backbone Sequence', 'Nucleotide Sequence of Zinc Finger'
- We wanted to convert this information into FASTA format.
  - We wrote a function that converted our original file into fasta format (in the Dropbox: iGem > chip > fasta.csv)
  - The file FASTA_total (also linked above) contains the FASTA for all 50000 sequences (including the 100 controls).
  - For those curious, the FASTA format just a format that looks like this:

>Header (For us the header is: Target, Backbone #, Helix Sequence, Backbone Sequence)(The header for the controls are: Index Number, 'control')
 Sequence (In our case, the nucleotide sequence of the zinc fingers)

Generated WebLogos for Final Chip

AAA	ACC	CTC
CTG	GAC	TGG

FASTA-Formatted Chip Data:

>NNN(Target Triplet) BB# Helix Seq.

Nucleotide seq. of ZF

Bioinformatics Candids

zif268 sequence by memory. You know you've stared at too many zif268 sequences when...

File:HARVPrimer Index iGEM 2011.xls

Design of Plate Practice Sequences

While we wait for the chip to come in, we have a number of techniques and protocols that we can practice on beforehand, so that when the chip comes we'll be ready to go to use what they give us. We will be practicing the following techniques:

Cutting ZF1 out of our oligos
Inserting ZF1 into the expression plasmid in between the omega subunit and the linker before F2
Verifying that combination of our F1 from the oligo with the plasmid produces a viable, functional ZF
Amplifying subpools of oligos for testing
Inserting the expression plasmids into the E. coli containing our selection genome
Verifying that our ZF-binding site/GFP expression paradigm works

To this end, we will be ordering a 96-well plate from IDT containing oligos that will simulate the entire tube of oligos that we will receive from Agilent in four weeks. These oligos will consist of the following:

6 positive controls (we know which DNA sequences these bind to)
- 3 of them being the F1 fingers of Zif268, OZ052, and OZ123
- 3 of them being ZF F1s derived from CODA.
90 generated sequences, picked from a subset of the chip
- These are picked evenly across the 9,150 sequences generated on the cihp for the TGG triplet F1 target from the colorblindness "bottom finger" target, GTG GGA TGG. This particular target was chosen because the F2/F1 is a GNNTNN combo, which might be more likely to get hits from our chip generation sequences.

The primer tag sequences for the 90 generated sequence subset will be the same as they are on the chip (for the sake of explanation, we will refer to them now as P1F and P1R in this paragraph). The positive controls will be flanked immediately by the same primers as the generated subset so that we can amplify everything as one pool altogether should we need to (so this will be P1F and P1R). However, we will also put an additional set of primers outside of the P1F/P1R primers for the positive controls so that we can specifically amplify the positive control subpool, should we want to. These primers will be the same as the primers for the positive control on the chip (which will be called P2F and P2R here).

To recap, on the chip we will have the following oligos :

45750 other oligos for the 5 other target sequences
Oligos (TGG set, 9150 total):   | P1F | type II binding site | generated F1 | type II binding site | P1R |
Oligos (+ control, 100 total):  | P2F | type II binding site |  control F1  | type II binding site | P2R |

In our test pool of 96 sequences, we will have two types of oligos (note the two pairs of primers around the positive controls):

Oligo (TGG set, 90 total):          | P1F | type II binding site | generated F1 | type II binding site | P1R |
Oligo (+ control, 6 total):   | P2F | P1F | type II binding site | generated F1 | type II binding site | P1R | P2R |

Once we get our test sequences back from IDT, they will come in a 96-well plate with one oligo in each plate. We should make a mixture using some of each well in order to create a tube that contains all 96 sequences. This will simulate the tube that we will receive from Agilent, except instead of 55,000 sequences we will have 96 sequences only in this tube. From here, we can practice using this as a library.

We can pretend that this tube is just 96 generated sequences on the chip, treating the positive controls as if they were also generated sequences (we only include them in the 96 to ensure that we will indeed get a "hit" from this practice screening). Thus, we can just use the P1F/P1R primer set to amplify all of them in order to use them for the subsequent steps.

These subsequent steps will be those that were outlined above, namely cutting out the F1 sequence from each oligo, ligating this F1 into our expression plasmid, putting the expression plasmid into our selection strain, observing colonies which get infused with ZFs that bind to our target site (the "hits"), and sequencing the colonies that get hits to determine which ZF they are expressing.

We will be repeating these exact same steps once we get the chip, so if we can perfect our protocols with these practice sequences, we should be golden when the chip comes in.

June 30th

Lambda Red, Backbone, and Sequencing PCR

Gel run on the presence of a Lambda Red protein in the pKD46 plasmid showed that it is indeed present, so our recombination failures have not been due to an incorrect plasmid.
Gel run on the backbone of pZE21G plasmid was success and took us one step closer to obtaining all parts necessary for the three part assembly
Gel run on the pyrF and rpoZ was success
- Therefore we sent the PCR products and primers to GENEWIZ for sequencing again

pKD46, pZE21G, and PyrF and rpoZ loci 6/30/11

pZE21G backbone:

Since last night's PCR was successful, we will redo it with a few protocol adaptations to get a cleaner product and to increase our yield when we purify
KAPA mastermix and protocol: primers HindIII-F and KpnI-R
- template: pZE21G miniprepped plasmid, 1µL
- 2 min elongation time, 30 cycles
- 2 samples at 55˚C annealing, 2 samples at 60˚C

Lambda red and MAGE:

Yesterday's prep produced tiny colonies on the MAGE plates and (so far) none on the kan-ZFB plates. Just in case it didn't work, we will redo the lambda red using even more DNA and perform a second round of MAGE using culture from yesterday that was not plated.
same procedure, but with the following changes:
- 5µL kan-ZFB (about 1 mg)
- recover 3 hrs
- kan-ZFB: plate 100µL and 2 mL on kan plates
- MAGE: plate 1µL and 10µL on amp plates
To see if the colonies on the MAGE plate knocked out HisB, we chose 24 colonies, resuspended them in water, and put half the cells in LB (complete media) and half in NM media (does not have histidine). 96 well plate, 150µL media, grown overnight at 30˚C.

ZF Expression Plasmid Ultramer and Primer Design

Today, we designed primers ZF_073 through ZF_085 as listed in the iGEM Primer Index spreadsheet. These were basically two sets of primers: the primers to clone out the omega subunit and linker, and the ultramers that would construct the last part of the linker along with the type II binding sites and F2/F3 fingers. One should refer to the primer list for the sequences.

Note: the annealing sequence for the ultramer overlap contained a 72 degree melting temp hairpin. To get around this, I changed one of the codons in the F2 backbone. The F2 backbone begins with "FQCRIC", and so I changed the codon for the arginine (R) from CGC to CGT, which resolved the hairpin problem.

June 30th - Bioinformatics

Updated Primer list and FASTA formatting

We ran into a small hiccup, when we were informed that we had forgotten to reverse translate the reverse primer sequences that were being appended to the generated sequence. This is because the primer sequences we were given were the sequences for the actual primers, rather than sequences to which the primers would bind. Luckily, we caught this error! We did have the re-run the generator because we had to make sure that our generated sequences did not contain the new primers.

Here is the updated primer list:

This is the set of final target sequences with assigned forward and reverse primers (tags for PCR):

Disease	Target Sequence	Forward Primer (5'-3' NOT REVERSE COMPLEMENT)	Reverse Primer (5'-3' REVERSE COMPLEMENT)
Colorblindness	GCT GGC TGG	ATATAGATGCCGTCCTAGCG	TGGGCACAGGAAAGATACTT
Colorblindness	GCG GTA ACC	CCCTTTAATCAGATGCGTCG	GGTCGCCCTTATTACTACCA
Familial Hypercholesterolemia	GGC TGA GAC	TTGGTCATGTGCTTTTCGTT	TCTGAGTATCCGATACCCCT
Familial Hypercholesterolemia	GGA GTC CTG	GGGTGGGTAAATGGTAATGC	GCTATATCCGGGGAATCGAT
Myc-gene Cancer	GGC TGA CTC	TCCGACGGGGAGTATATACT	TTGGCCTGAAGCAGTTAGTA
Myc-gene Cancer	GGC TGG AAA	CATGTTTAGGAACGCTACCG	GGGAGGGAACGGAGATTATT
Controls	n/a	GTACATGAAACGATGGACGG	CGCTGAGGAGACTATACCAG

There was also a small error in the FASTA formatting. There are not supposed to be any spaces in the header, so the spaces were replaced with underscores.

Example:

>1_control

GTACATGAAACGATGGACGGGGTCTCAGCCATTCCAATGTCGTATCTGTATGCGTAATTTTTCACGCAAACACCATTTGGGTCGTCATATCCGTACGCACACGGTGAGACCCGCTGAGGAGACTATACCAG

July 15th

Team Wolfe

Thio kan-ZFB-wp-hisura optimizing PCR results:

The gel stab PCR produced a product of the right size, but the 2kb side product was still brighter. The 2-PCR protocol also still had substantial side products but at least they did not completely overshadow the real product. We will accordingly go ahead and do a gel extraction on the 2-PCR samples so that we can try lambda red with them next week.

Different attempts and thio kan-ZFB-hisura PCR 7/15/11

pSR01 growth phenotype results:

Unfortunately the computer hooked up to the plate reader spontaneously restarted during the night to download updates, so we lost all the data. Just by looking at the plate, it still seems like IPTG is inhibiting growth. The ∆HisB∆pyrF∆rpoZ controls also did not grow, probably because the plate the colonies were taken from was too old, so we will restreak from the glycerol stock and set up the plate reader again this weekend.

Team ZF

PCR of electro comp expression plasmids

We performed a mini-prep of the cultures that we grew overnight of the electrocompetent cells. We then performed a PCR on the product of the mini-prep, checking for the 1.4 kb cross junction to confirm the presence of our omega+ultramers+spec plasmid. We used the same recipe as the PCR we performed on Tuesday.

Description of gel below.

No bands appeared for PCR peformed on a 1 to 10 dilution of the cultures. Miniprep product from colonies 78, 79, and 82 had the expected band at 1.4 kb, while 80 and 81 had a band that was slightly smaller than the the expected product size. We saw a similar band in our PCR of the isothermal assembly reaction product. We are unsure exactly what is causing this band. If either the omega subunit or ultramers were missing from the plasmid, a similar sized product would result since both are ~350 bp. We are curious if a plasmid can still be formed if one of these components were missing.

We checked the concentrations of our miniprep product to see if that would explain our problem.

ID     Conc. (ng/ul)     260/280     1.4 kb band?
78      16.12             2.10            Y
79      41.64             1.64            Y
80       5.84             2.01            N
81      61.24             1.62            N
82      20.25             1.72            Y

We can't tell whether the concentration of the miniprep product contributed to the strange band we saw. 81 had the highest concentration but still didn't work. We decided to try plating 4 more colonies from 80 and 81, to see if any of them have the appropriate band.

We also decided to make final plates of cultures 78, 79, and 82, using 2 ul of culture and 50 ul of LB+spec. They were plated on new spec plates. We will incubate them at 37* overnight.

Checking the expression plasmid plates

All the plates had colonies on them, although there were still areas of unspecific growth, presumably because of uneven dilution of the spec into the LB plates.

We made cultures of all the chem comp cells (77, 83, 84, 85) and the electro comp cell that did not have the correct insertion (80, 81). We picked 4 colonies from each plate, resulting in a total of 24 cultures. We have left them in the 37* shaker overnight, and tomorrow plan on performing a miniprep and PCR to check for the cross-junction.

PCR to check for omega+ultramers

We performed a PCR on the five electro comp miniprep products, to find out what may be missing. We used the omega_F+pLacO (index: 73) as our forward primer, and each of the respective reverse ultramers as our reverse primers (index: 78-82). We had an annealing temperature of 58* and an extension time of 30 seconds, and the expected product size is 646 bp.

Team ZF results in lanes 8-12

Strangely, we did not get results for sample 78 (FH bottom), even though we got a band there in a PCR earlier today that used the junction primers. We got positive results for samples 79 and 82, and everything else seems to check out with these two samples (bands present in the correct size with junction primers from both isothermal assembly and miniprep templates). However, we are still having problems with samples 80 and 81, which may be a problem with the colonies that we picked. For now, we will assume that the isothermal assembly worked, due to colonies growing on the spec plates for samples 80 and 81, and that we had simply picked bad colonies. We will find out tomorrow if other colonies from the same plate give us the same results.

July 18th

Team ZF

Sending expression plasmids out for sequencing

We decided to send out the expression plasmids that had bands at approximately the correct size out for sequencing. We originally wanted to sequence the plasmids, but our miniprep concentrations were not high enough. Apparently, we should be getting high yields from minipreps, but thus far our yields have been around 50 ng/ul at the highest.

We decided to sequence the unpurified PCR products instead. In order to do this we had to re-do the PCRs for Zif268, FH bottom (78), CB top (79), Myc 981 (82). Below are our 1% e-gel results, verifying that we had appropriately sized bands:

Gel of cross junction of Zif268, FH bottom, CB top, Myc 981

Our final samples sent out for sequencing are:

Index     Sample ID             Index     Sample ID
 1         77_1                  11        80_3
 2         77_2                  12        80_4
 3         77_3                  13        -
 4         77_4                  14        83_2
 5         84_1                  15        83_3
 6         84_4                  16        83_4
 7         81_1                  17        Zif268
 8         81_4                  18        FH_bottom
 9         80_1                  19        CB_top
 10        80_2                  20        Myc_981

Making more cultures and plates of our expression plasmids

We picked two more colonies from plate 85 today and made 5 ml cultures from them. We also made 2 fresh cultures from the old 85 cultures, by taking 50 ul of old culture and 5 ml LB+spec. We will leave them overnight in the 37* shaker and perform minipreps and PCRs on them tomorrow.

We made positive control cultures from 81.1, 81.4, 80.1, and 80.2, in order to test our minipreps tomorrow. They reactions have a wide range of concentrations post-miniprep, and we are curious to see if the same will happen after performing a miniprep a second time.

Another way to figure out if our expression plasmids contain the appropriate insert is by using a restriction enzyme to cut it and then performing a PCR on the linear DNA. We had previously inserted 2 cutsites on our plasmids, Bsa1 (for insertion of finger 1) and Xba1. The lab already has Xba1, and we ordered Bsa1. Xba1 can be affected by methylation if it is preceded by 'GA' or followed by 'TC' [19]; we checked and our sequences should not be affected.

We also re-plated 78, 79, and 82 today, one set of plates with 1 ul of culture, and the other set with 10 ul.

Creating the 96 well test plate

Team Wolfe

SNOWMAN!

EcNR2 lambda red (Noah's prep):

Noah remade the kan-ZFB-wp-hisura insert for us with the kan cassette in the opposite orientation from the his3 and ura3 genes. (The kan cassette is under a strong promoter and does not have a transcriptional terminator, so it's possible that RNA polymerase might keep transcribing through the end of kan and into his3.) He also used it for lambda red in EcNR2, and a couple of plates look like they may have a couple colonies.
picked 4 colonies, diluted in 20µL H20 and used 1µL as template for 1529620 locus PCR. The rest was grown in LB+kan.

Lambda red with Noah's kanZFBhisura:

We recently discovered that the kan plates we had been using were very old, and that might be why we got that weird crystalline lawn of colony-like things. We will retry lambda red in the ∆hisB∆pyrF∆rpoZ +pKD46 strain and see if this solves the problem
1.5mL cells divided in two: half for kan-his-ura (300ng) and half as a negative control (water)

Thio insert:

In case lambda red also does not work, we will try to add phosphothioate bases to the insert, but only to the lagging strand 5' end (so only the Ura3 side). Since our primers will have very different melting temps, we will try 2 different reactions:
Touchdown PCR:
- template: Noah's kan-ZFB-hisura (163ng/µL) diluted to ~10ng per reaction (4 reactions)
- primers: kan_f+homology, Ura3 R phosphothioate
- 2 cycles at each annealing temperature (67, 66...57) for 11 cycles followed by 15 more cycles at 57; 3 min elongation
Gradient PCR:
- same as above but with 12 reactions, annealing temperatures from 57-67˚C
Results: most of the gradient reactions produced a faint but clean band at 3kb. The touch down PCR had a stronger 3kb band but also lots of side products.

Thio kan-ZFB-hisura (Noah's) gradient part 1 7/18/11

Thio kan-ZFB-hisura (Noah's) gradient part 2 and touchdown 7/18/11

Team TolC

Primers

Created and ordered primers in order to test the presence of MAGE rpoZ knockout oligo
- Primers made are named
  - rpoZ_MAGE_KO plus 4, rpoZ_MAGE_KO minus 4, which have all 4 of the stop codons
  - rpoZ_MAGE_KO plus 2, and rpoZ_MAGE_KO minus 2, which have only the first two stop codons.

Kan Plates

Performed control experiment on Kan plates by growing up liquid culture from glycerol stock and then spreading on Kan plate in order to determine the speed of growth and intensity of the presence of Kan on the plates
Will check on these tomorrow.

Kan-ZFB-wp insertion

Picked 5 colonies from ZF090 and ZF091 plates for a total of 10, ZF092 had too few colonies to pick from
- Placed colonies in 20 μL of water and used 1 μl for a 20 μL PCR reaction
- Then took 10 μL from 20 μL dilution and added to 100 μL of LB in 96 well plate and put in 30°C fridge, at 3:19 pm
- Same protocol as KAPA PCR with the following changes made
  - Step 3, gradient for annealing, 55°C - 77°C, for a range of 55,57,59,61 and 63°C for the two rows of 5 PCR tubes each (placed leftmost)
  - Step 4, Extension, 1 min
  - Step 5, 25 cycles total
- Name: TOLCGRAD, PCR5 machine.

July 21st

Team ZF

Checking colonies 78 and 79

All of the cultures grew overnight, so we performed a miniprep on them to obtain the plasmids.

Plasmid concentrations after miniprep

Our concentrations were better than they have been in the past; notably, after the addition of buffer P2, our solution actually turned a bright blue (indicating lysis of the cells), which we had not seen before.

We then ran a PCR on our miniprep product, to check for our desired insert. We used our usual protocol for a PCR of the expression plasmid cross-junction.

PCR results, note that some lanes do not show strong bands

Some of the products did not show up very strongly, but we sent them out for sequencing in case it was a PCR/gel error.

Sending out our expression colonies for sequencing

We sent out the samples from yesterday that had no more than 1 SNP for reverse sequencing. In addition, we also sent out 78 and 79 for forward and reverse sequencing.

Reverse sequencing: 77.1, 77.3, 77.4, 78.1, 80.1, 80.2, 80.4, 81.1, 81.4, 82.1, 83.4, 84.1, 84.4, Zif268
Forward and reverse sequencing: 781, 78.2, 78.3, 78.4, 79.1, 79.2, 79.3, 79.4

For sequencing, we used the forward primer pZE23G_3581_F CCAACCTTACCAGAGGGCGC (Junction forward) and the reverse primer pZE23G_2123_R CGAACGACCTACACCGAACT (Junction reverse)

We did a PCR of the sequences from yesterday that we want sequenced again.

PCR results, looking good

The bands were clear, and we will send these products to be sequenced.

Gel Extraction and Isothermal Assembly of OZ fingers+homology

We ran a gel extraction of our PCR product from yesterday, so that we could use it for isothermal assembly later. Strangely, we got bands that were larger than our largest theoretical product.

Prepare yourself to be gel-extracted

We had the following yields from our gel extraction:

 ID         Conc. (ng/ul)            260/280
 OZ052      96.3                     1.93
 OZ123      125.5                    1.91

Based on these concentrations, we used the following recipes for our isothermal reaction:

OZ052:
- Spec: 0.63 ul
- OZ052: 1.56 ul
- Omega: 0.13 ul
- Water: 1.56 ul
- Isothermal assembly solution: 7.5 ul
OZ123:
- Spec: 0.63 ul
- OZ123: 0.14 ul
- Omega: 0.13 ul
- Water: 1.60 ul
- Isothermal assembly solution: 7.5 ul

We left the isothermal assembly product in the -20* freezer, and will perform the transformation tomorrow.

Team Tolc

Team Wolfe

Lambda red culture did not grow colonies overnight on a kanamycin plate. This may be due to a low time (4.8ms) during the electroporation.
Repeated lambda red using the same procedure. Got a similar time constant and noticed that the water negative control had more cells than the culture containing the insert, but we went ahead and plated 1mL of each on kan plates.
Also replated the 7/20 lambda red culture to see if we can get any good cells (1.5mL).

August 3rd

Team ZF

Yesterday's last digestion and PCR results

We ran a gel of our digestion product from yesterday, and our PCR to clone out Zif 268 to construct the reporter plasmid.

Our results for the final digestion we ran yesterday, and the PCR to clone out Zif 268.

Innoculation of Zif 268

We were running low on Zif 268 plasmids, so we decided to make a new culture from the glycerol stock. It has been left in the 37* shaker overnight.

Sending Pos Con 77 and swap controls for sequencing

We performed a miniprep on our cultures of Pos Con 77, and OZ052 swap, OZ123 swap, and Zif 268 swap.

Results of our miniprep.

Once again, we got unusually low yields. We decided to test the quality of our spec, to see if that was the problem. We grew PZE22G(which does not have spec resistance) in spec to see if it grew. By the end of the day, nothing had grown.

Still, we decided to PCR the miniprep product, since any DNA that is in the product should be amplified. We performed our usual protocol for a cross junction PCR, but we repeated the reaction for 30 cycles.

HARV2011.8.3 junction pcr 2 and gfp annotated.png

Some of the bands varied in size, but we decided to send it all in for sequencing.

Constructing the reporter Zif268 Plasmid

PCRs of Zif 268 and GFP

We decided to perform more PCRs to clone out Zif 268, since it will have to be gel purified. This reaction had the same conditions as yesterday's.

We also received the GFP plate today, so we decided to perform a colony PCR in order to get out the sequence that encodes GFP. We used our GFP Forward and GFP Reverse (Primer Index: 146 and 147) for the reaction, had an annealing temperature of 58*, and an extension time of 30 seconds. The expected product size was ~700 bp.

The last four lanes show the expected band size of ~825 bp for GFP. However the bands are comparatively faint.

Gel Purification of Zif 268 and GFP

We performed a gel purification of our PCR products.

We made a 1% agarose gel to gel purify our zif clone and GFP. The bands for GFP are much fainter than those for Zif 268.

After gel purification, Zif 268 had a concentration of approximately 110 ng/ul.

While we had a bright band for Zif 268 on our gel, our band for GFP was much fainter, so we decided not to gel purify it, and instead to re-do the PCR (4 times) for that reaction.

We ran another PCR to get out GFP.

Our yield for the gel extraction of GFP was 10.2 ng/ul.

Isothermal assembly and transformation

Our yield for the gel extraction was lower than what we wanted, but we figured we would try the assembly anyway. This meant that we needed 2.9 ul GFP and 0.9 ul backbone. Ideally all the DNA takes up 2.5 ul when performing an isothermal assembly. We decided to perform 2 reactions, so that one of them might work.

First recipe (total volume 10 ul):
- 1.9 ul GFP
- 0.6 ul backbone
- 7.5 ul isothermal assembly mix
Second recipe (total volume 11.3 ul):
- 2.9 ul GFP
- 0.9 ul backbone
- 7.5 ul isothermal assembly mix

We performed a transformation using ChemComp cells, plated 100 ul, and left them in the incubator overnight.

Practice plate ligation

After seeing the results of our third oligo digestion yesterday, we were confused about why the reaction was not working. After talking with our teammates, we realized that we had been performing the reaction on single stranded DNA, instead of our double stranded PCR product. We performed the digestion again today with oligos 1 and 2, using the following recipe:

15 ul DNA
0.5 ul enzyme
85 ul buffer/BSA

After letting the reaction sit at 37* for about 45 minutes, we performed a PCR purification, and then ran the product on a gel:

We could see bands of the appropriate size, after digesting our PCR product. Unpure = cut without PCR purification.

Finally, we had gotten bands at the appropriate size! We noticed that there were multiple bands smaller than our uncut oligo. We figured the smallest band was the one we were looking for. The one that was slightly larger was likely the result of the enzyme only cutting at one end of our oligo. We wondered whether all of our product would have been the appropriate size if we had let the reaction sit at 37* for a longer period of time. Regardless, we decided to use this product in our ligation reaction. If both ends of the oligo aren't cut, then it should not be able to bind with the backbone.

We performed a ligation reaction with our cut CB Bottom and our digested oligos, using the following recipe:

5 ul ligation mix
4 ul backbone (~20 ng/ul)
1 ul insert (~15 ng/ul)

This would leave to a vector to insert ratio of 1 to 8, which is what is normally used for ligation reactions.

This is how we calculated the amounts of inserted needed for our ligation:

PCR product: ~60 ng/ul
We want 1 ug of DNA to be cut, so that after the PCR purification, when we elute in 30 ul we will get a concentration of ~30 ng/ul.

In practice, we end up losing some of our product, so we ended up with 15 ng/ul.

After letting the reaction sit at room temperature for 1 hour, we transformed ChemComp bacteria with the ligation products. We plated 50 ul and 400 ul of the transformation and left the plates at 37* overnight.

Team Wolfe

Overnight MAGE round 3 colonies grew - 1µL, 10µL, and 100µL used with (too)many cells on 100µL plate and a workable amount on the 1µL plate.
MAGE round 3 PCR
- 10µL reactions
- Primers: HisB VE KO Check_R, His_F and PyrF KO Check_F, PyrF IR
- 47 colonies tested for knock out of HisBUra3 and 47 colonies tested for knock out of pyrF
- HisB Control - selection strain with same primers
- PyrF Control - Colony 1 with PyrF forward and PyrF internal reverse primers
Reverse Touchdown PCR to obtain the kan backbone with homology from pSB4K5 biobrick plasmid:
- Used annealing temperature range of 58 to 68 with two rounds elongation at 2 degree intervals and 15 elongation cycles at 68 degrees.
- PCR failed

A successful PCR would have resulted in a 3.5-4Kb band.

Miniprep of pSB4K5 strain for future PCR yielded 15ng/µL
Plate reader
- Wells 1, 8, 15... 36 LB+tet/amp
- Wells 2,9,16...37 1mM 3-AT
- Wells 3,10, 17...38 2.5mM 3-AT
- Wells 4,11, 18...39 5mM 3-AT
- Wells 5,12, 19...40 10mM 3-AT
- Wells 6,13,20...41 25mM 3-AT
- Wells 7,14,21...42 50mM 3-AT
- Wells 1-7 = empty
- Wells 8-14 = selection strain
- Wells 15-28 = single selection strain + pSR01 colony (duplicates)
- Wells 29-42 = second selection strain + pSR01 colony (wells 33-35 were not usable)
MAGE rounds 4&5 completed, colonies plated at 1µL, 10µL, and 100µL volumes.

Team TolC

Set up and ran plate reader for the growth rates of ECNR2+kan-ZFB-wp+zeocin+spec plasmid, ECNR2+kan-ZFB-wp+zeocin Δspec plasmid, ECNR2, and ECNR2+zeocin+spec plasmid Δkan-ZFB-wp in .04% SDS and 25, 12.5, 6.25, 3.125, 1.5625 µM

August 17th

Justin

Miniprep of negative control library colonies

Today I miniprepped the 24 colonies that were picked and grown to saturation last night. These 24 colonies should contain a good number of the 18 practice plate plasmids within them. The minipreps were very successful for these strains, yielding concentrations from ~30-60 ng/ul. Nida ran a junction PCR on the 24 miniprepped products, and we sent them out for sequencing in order to determine which of the 18 practice plate oligos are contained within these 24 colonies. The yields of the minipreps can be seen below:

Miniprep concentrations and purities

Selection plasmid concentrations

In order to proceed with the experiment #2 outlined yesterday, Nida and I combined the miniprepped products (everything except for sample 6, which had very low miniprep yields for some reason) in equal molar ratios according to their concentrations. This constitutes our negative control library, containing complete zinc fingers targeted towards the CB bottom target, but not towards the Zif268 binding site.

I then took the negative control library and spiked it with varying amounts of Zif268 whole plasmid, yielding mixes that contained in total 500 ng of plasmid. Thus, for the positive and negative plasmid controls, they each contained 500 ng of Zif268 and 500 ng of negative control library, respectively. For the 1:10 dilution, there were 50 ng of Zif268 and 450 ng of negative control, and so on. The Zif268 plasmid that was used originated from the midiprep that Nida performed last Friday.

The 8 mixtures outlined yesterday were then transformed into the EcNR2 selection strain, and plated on spec plates. This will simply select for bacteria that contain plasmid, but not specifically for those that contain Zif268 plasmid.

To see the volumes used for creating the plasmid dilutions, see the following file: Practice Library Assembly

Chip library assembly

PCR of Chip Oligos

With Sri and Dan’s guidance, I performed a qPCR on the chip oligo's using the protocol outlined in the supplementary section of Sri's paper. I performed six reactions using the appropriate primer in each case (CB top, CB bottom, FH top, FH bottom, Myc 981, Myc 198). I used the following recipe for the PCR (total volume 200 ul):

100 ul Sybr Green master mix
200 nm primer (4 ul each of 10 um primer)
2 ul chip
90 ul water

I ran the reactions on the thermocycler, while standing by to see the graphs being produced, using the following program:

95* for 1 minute
Initially, the reactions occur at an exponential rate. During this period:
- 95* for 10 seconds
- 62* for 30 seconds
Once the reaction began to plateau, I stopped the reaction. Prior to this point all the oligos were being amplified equally. Once the plateau occurs, amplication occurs at varying rates. This took about 12 cycles total.

FH Top samples had slightly less volume, and plateaued earlier. This may have occurred due to too little water or master mix being added.

I performed a PCR purification on the PCR product at got the following yields:

Name        Conc.        260/280 
 CB Top:     18.2         1.83
 CB Bottom:  25.1         1.78
 FH Top:     20.3         20.3
 FH Bottom:  21.4         21.4
 Myc 981     26.1         1.73
 Myc 198     19.7         1.84

In order to confirm the nanodrop readings, I ran 1 ul of each sample on a 4% e-gel. We ran a low range quanitative DNA ladder, at varying dilutions.

The results of the qPCR on our library

When comparing the intensity of the bands to the ladder, it does indeed look like there is approximately 20 ng/ul DNA in the products.

August 18th

Justin

Transformation results

The plates of transformed bacteria yesterday were uneven in their efficiencies because some of the plates had a low time constant for the electroporation (around 4.8) when a good time constant was around 5.8. We got excellent efficiency in the transformation for Zif268 alone, but for the plasmid mixes that included the negative control library, we got poor time constants. We still got colonies, but instead of getting a lawn of bacteria there were approximately 150 discrete colonies on the plate.

To get around this, Noah picked colonies from the plates and inoculated fresh LB/spec with them, and let them grow to saturation over the course of the day. We used these resulting saturated cultures in our selection plates later in the day.

Pre-transformation library selection plates

Today, Noah and I prepared selection plates to test our ability to distinguish a positive hit among negative controls in varying proportions. The pre-transformation aspect refers to the fact that it is the Zif268 plasmid that is diluted into the negative control plasmids before transformation, rather than diluting Zif268 bacteria into the negative control bacteria after transformation (this is analogous to how it will be done with the chip). Using the negative control library assembled from yesterday, we created a 96-well plate with the following dimensions.

Going horizontally (each column):

1: Positive control (only Zif268)
2: Positive control (replicate of column 1)
3: 10^-1
4: 10^-2
5: 10^-3
6: 10^-4
7: 10^-5
8: 10^-6
9: Negative plasmid control (only negative control library)
10: Negative plasmid control (replicate of column 9)
11: No plasmid control (Wolfe ECNR2 strain without any plasmid)
12: No plasmid control (replicate of column 12)

Going vertically (each row):

A: LB + carb
B: NM + his (0.1%)
C: NM
D: NM (replicate of row C)
E: NM + 1 mM 3-AT
F: NM + 3 mM 3-AT
G: NM + 10 mM 3-AT
H: NM + 25 mM 3-AT

We left this in the plate reader overnight.

Selection plate seeding protocol

Notes: Each well contained 150 ul of liquid, and a 1/100 dilution of bacteria at an OD of 3 (so this would be adding 1.5 ul of bacteria). The bacteria were grown up in LB to saturation and were washed in NM twice. This was accomplished by the following steps:

Take the equivalent of 800 ul of 1.5 OD bacteria into a tube.
Centrifuge the bacteria into a pellet (max speed for 1 min)
Pipette off as much LB as possible, using a 1000 ul pipet first and then switching to a 200 ul pipet.
Resuspend the bacteria pellet in 500 ul of NM (1st wash).
Recentrifuge into pellet.
Repeat steps 3 and 4 (2nd wash).
Resuspend in 400 ul of NM (this gets it to an OD of 3).
The bacteria sample is now ready to be used.

GFP reporter plasmid miniprep

Today, Nida and I miniprepped 6 ml of GFP reporter cells, consolidating the equivalent of 2 minipreps into one column. However, the yields and purities were pretty terrible, with yields of 7 and 11 ng/ul and purities that were much greater than 2. This is likely to be caused by the fact that the cultures that we miniprepped were prepared by spiking 3 ml of LB/spec with 1 ml of saturated culture in an attempt to grow up a lot of culture in a short period of time. There was likely a lot of cell lysis and general cell debris that hindered the miniprep, causing it to give such terrible yields.

We inoculated 12 more ml of culture for miniprepping tomorrow morning, since we are low on time. This should hopefully give us enough culture to work with such that the miniprep will eventually give us the quantity/concentration of DNA required for transformation and/or plasmid library testing.

Chip library assembly

Digestion of library and CB bottom backbone

We digested our CB bottom library pool and CB bottom plasmid with Bsa1 using the following recipes:

Library (40 ul total)
- 30 ul pool library (600 ng)
- 0.75 ul enzyme
- 4 ul buffer 4
- 1 ul bsa
- 4.25 ul water

CB bottom backbone (10 ul total)
- 4.2 ul dna (1000 ng)
- 1 ul enzyme
- 1 ul buffer
- 0.25 ul bsa
- 3.55 ul water

We ran the digestion for 2 hours at 37*. Then we heat inactivated the enzyme at 65* for 20 minutes.

Phosphatase reaction

We then took the product of the digestion, and added phosphotase to prevent the pieces from re-ligating by removing the 5' phosphate. We used NEB Antarctic phosphotase. We used the following recipes:

CB bottom backbone
- 10 ul backbone
- 1.22 ul buffer
- 1 ul phosphatase

We ran the reaction for 4.75 hours at 37*, and then heat inactivated the enzyme at 65* for 20 minutes.

We then performed a PCR clean-up on the product, with the following yields:

Library: 9.8 ng/ul (total 294 ng)
CB bottom: 11 ng/ul (total 330 ng)

Planning for ligation of library and backbone

We were unable to perform the ligation today. If we want to use 200 ng per ligation reaction we need 1000 ng of DNA, which is the amount we started with. We can cut some more backbone, or phosphatase the backbone I had cut earlier (conc: 69 ng/ul). We can also use 100 ng of backbone instead.

Based on the yields of the PCR clean up, as assuming 100 ng of backbone, we'll need the following amounts of insert for our ligations:

Insert:backbone   Amount of insert (ul)
 2:1               1
 3:1               1.5
 5:1               2.5
 8:1               4

This is because our insert is 137 bp and our backbone is 2788 bp. For equal molar ratios, we'll need 4.9 ng (or 0.5 ul) of insert for a 1:1 insert:backbone.

We also plan on running cut backbone (no phosphotase), and phosphotased backbone as controls.

@@ Line 453: / Line 453: @@
    elem.style.display = 'none';
 if(k==409){
-   elem.style.display = 'block';
-}
-elem = document.getElementById('925');
-  elem.style.display = 'none';
-if(k==411){
-   elem.style.display = 'block';
-}
-elem = document.getElementById('926');
-  elem.style.display = 'none';
-if(k==412){
-   elem.style.display = 'block';
-}
-elem = document.getElementById('927');
-  elem.style.display = 'none';
-if(k==413){
     elem.style.display = 'block';
 }
@@ Line 475: / Line 460: @@
 <!-- ----------------------------------Calenders--------------------------------------------------------------- -->
-<div id="vse_students">
+<br><div id="vse_students">
 <div id="desno_students">
@@ Line 719: / Line 704: @@
 </span ></td><td>
 <span id="student" onclick="show(58)">
 </span ></td><td>
 <span id="student" onclick="show(59)">
@@ Line 765: / Line 750: @@
 <span id="student" onclick="show(409)">
-</span ></td><td>24</td></tr><tr><td>
+</span ></td><td>24</td></tr><tr><td>25</td><td>26</td><td>27</td><td>28</td><td>29</td><td>30</td><td>31</td><td>
-<span id="student" onclick="show(411)">
-</span ></td><td>
-<span id="student" onclick="show(412)">
-</span ></td><td>
-<span id="student" onclick="show(413)">
-</span ></td><td>28</td><td>29</td><td>30</td><td>31</td><td>
 </table>
 </div>

Position	Very Phobic	Hydrophobic	Neutral	Hydrophillic
6	285	85	204	2782
5	542	312	1334	1169
4	3334	14	0	9
3	191	203	1417	1536
2	91	211	1819	1236
1	138	164	1604	1451
-1	468	90	1257	1542

Position	Polar	Nonpolar
6	2917	440
5	2290	1067
4	9	3348
3	2830	527
2	2652	705
1	2555	802
-1	2784	573

Disease	Target Range	Binding Site Location	Bottom Finger	Top Finger	Bottom AA (F3 to F1)	Top AA (F3 to F1)
Colorblindness	chrX:153,403,001-153,407,000	370	GTATTTGTT	GGGCCTGCT	N/A	N/A
Colorblindness	chrX:153,403,001-153,407,000	3627	GCTGGCTGG	GCGGTAATG	EGSGLKR.EAHHLSR.#######	RRDDLTR.QRSSLVR.#######
Cystic Fibrosis	chr7:117,074,084-117,089,556	14767	GCAGGTGAT	AAAGAGCCC	QNGTLGR.EAHHLSR.#######	N/A
Familial Hypercholesterolemia	chr19:11,175,000-11,195,000	14001	GGCTGAGAC	GGAGTCCTG	ESGHLKR.QREHLTT.#######	QTTHLSR.DHSSLKR.#######
Tay-Sachs	chr15:72,674,944-72,688,031	5888	GTCTGGTCA	TCAAACTCC	DRSSLRR.RREHLTI.#######	N/A
Pancreatic Cancer	chr7:117,074,084-117,089,556	1739	GATCAAGCT	GTTTCAGTG	N/A	N/A

PDB ID	Binding Sequence	Link
1F2I	ATGGGCGCGCCCAT	[2]
1G2D	GACGCTATAAAAGGAG	[3]
1G2F	TCCTTTTATAGCGTCC	[4]
1MEY	ATGAGGCAGAACT	[5]
1TF6	ACGGGCCTGGTTAGTACCTGGATGGGAGACC	[6]
1UBD	AGGGTCTCCATTTTGAAGCG	[7]
1TF6	ACGGGCCTGGTTAGTACCTGGATGGGAGACC	[8]
1YUI	GCCGAGAGTAC	[9]
2DRP	CTAATAAGGATAACGTCCG	[10]
2GLI	TTTCGTCTTGGGTGGTCCACG	[11]
2I13	CAGATGTAGGGAAAAGCCCGGG	[12]
2KMK	CATAAATCACTGCCTA	[13]
2PRT	CGCGGGGGCGTCTG	[14]
2WBS	GAGGCGC	[15]
2WBU	GAGGCGTGGC	[16]

Acid	-1	1	2	3	5	6	7
A	77	140	210	197	0	312	85
C	12	24	1	6	14	0	0
D	413	16	694	258	0	142	14
E	125	74	152	107	0	58	132
F	0	0	22	0	10	0	0
G	12	201	328	125	0	177	62
H	93	144	232	652	0	51	17
I	70	21	3	26	0	94	73
K	108	372	46	169	6	321	52
L	176	37	20	22	3325	75	55
M	36	54	5	28	0	31	10
N	23	150	129	940	0	182	61
P	3	298	77	7	0	36	8
Q	813	158	180	13	0	136	30
R	870	539	137	55	3	428	2517
S	99	970	859	278	0	140	12
T	243	134	223	350	0	834	83
V	166	26	27	115	0	341	146
W	19	0	13	0	0	0	0
Y	0	0	0	10	0	0	1

'	A	C	D	E	F	G	H	I	K	L	M	N	P	Q	R	S	T	V	W	Y
A	10	0	99	55	0	29	122	20	32	332	2	59	55	63	255	87	24	43	0	0
C	0	0	15	0	0	3	0	0	0	5	0	0	6	0	31	6	14	0	0	0
D	99	15	94	92	0	39	62	6	84	342	15	120	55	42	277	290	87	21	0	8
E	55	0	92	42	0	34	77	1	38	141	2	39	4	29	134	28	90	26	0	1
F	0	0	0	0	0	0	0	10	0	0	0	22	4	0	2	4	6	0	0	0
G	29	3	39	34	0	38	56	0	14	126	1	95	28	47	119	125	38	7	0	0
H	122	0	62	77	0	56	118	9	103	498	4	88	24	26	87	159	70	2	0	0
I	20	0	6	1	10	0	9	6	8	95	3	5	17	3	62	16	17	4	0	0
K	32	0	84	38	0	14	103	8	84	386	24	44	19	102	269	163	113	22	1	0
L	332	5	342	141	0	126	498	95	386	174	32	686	16	112	362	276	875	360	0	8
M	2	0	15	2	0	1	4	3	24	32	0	7	2	11	39	14	3	1	0	0
N	59	0	120	39	22	95	88	5	44	686	7	8	36	28	120	254	84	34	1	0
P	55	6	55	4	4	28	24	17	19	16	2	36	0	3	29	150	21	13	11	0
Q	63	0	42	29	0	47	26	3	102	112	11	28	3	100	261	314	125	19	0	0
R	255	31	277	134	2	119	87	62	269	362	39	120	29	261	618	343	504	281	0	0
S	87	6	290	28	4	125	159	16	163	276	14	254	150	314	343	592	173	91	0	0
T	24	14	87	90	6	38	70	17	113	875	3	84	21	125	504	173	154	28	0	0
V	43	0	21	26	0	7	2	4	22	360	1	34	13	19	281	91	28	12	0	0
W	0	0	0	0	0	0	0	0	1	0	0	1	11	0	0	0	0	0	0	0
Y	0	0	8	1	0	0	0	0	0	8	0	0	0	0	0	0	0	0	0	0

Probability data for the 783 fingers that bind to GNN triplets. Note the high probability of leucine at position 4 and arginine at position 6.	Probability data for the 128 fingers that bind to TNN triplets. Note the high probability of leucine at position 4.	Probability data for the 16 fingers that bind to CNN triplets. There may not be enough data to consider this information statistically significant	Probability data for the 29 fingers that bind to ANN triplets. There may not be enough data to consider this information statistically significant
Probability data for the 298 fingers that bind to NGN triplets. The position 4 leucine motif remains. There is also a high probability (> 0.5) of a histidine at position 3 and an arginine at position 6.	Probability data for the 177 fingers that bind to NTN triplets. The position 4 leucine motif remains.	Probability data for the 244 fingers that bind to NCN triplets. The position 4 leucine motif remains. There is also a very high probability of an arginine at position 6.	Probability data for the 248 fingers that bind to NAN triplets. The position 4 leucine motif remains. There is also a very high probability (> 0.75) of an asparagine at position 3 and an arginine at position 6.
Probability data for the 234 fingers that bind to NNG triplets. The position 4 leucine motif remains. There is also a very high probability (> 0.75) of an asparagine at position 1 and a high probability (> 0.5) of an aspartic acid at position 2 and an arginine at position 6.	Probability data for the 247 fingers that bind to NNT triplets. The position 4 leucine motif remains. There is also a high (> 0.5) probability of an arginine at position 6.	Probability data for the 262 fingers that bind to NNC triplets. The position 4 leucine motif remains. There is also a very high (> 0.75) probability of an arginine at position 6.	Probability data for the 218 fingers that bind to NNA triplets. The position 4 leucine motif remains. There is also a very high (> 0.75) probability of a glutamine at position -1 and an arginine at position 6.

More Closely Related Backbones		More Distantly Related Backbones
Name	Sequence (with helix)	Name	Sequence (with helix)
44GLAS_DROME	FRCPI---CDRRFSQSSSVTTH-MRTH--	56EGR1_HUMAN	FAC---DICGRKFARSDERKRHTKIH---
38KRUP_DROME	FTCKI---CSRSFGYKHVLQNH-ERTH--	47MZF1_HUMAN	FVC---GDCGQGFVRSARLEEHRRVH---
124EVI1_HUMAN	YRC---KYCDRSFSISSNLQRHVRNIH--	23CF2_DROME	YTC---SYCGKSFTQSNTLKQHTRIH---
6HUNB_DROME	YECK---YCDIFFKDAVLYTIHMGY--H-	19ZEP2_RAT	YICE---ECGIRCKKPSMLKKHIRTH---
16SUHW_DROME	FPCEQ---CDEKFKTEKQLERH-VKTH--	49SDC1_CAEEL	VVC---FHCG-TRCHYTLLHDHLDYCH--
125CF2_DROME	YTC---PYCDKRFTQRSALTVHTTKLH--	27SDC1_CAEEL	LTC---AHCDWSFDNVMKLVRH-RGVH--
43EVI1_HUMAN	FKCHL---CDRCFGQQTNLDRH-LKKH--	130TTKB_DROME	YRC---KVCSRVYTHISNFCRHYVTSH--
118ADR1_YEAST	YPC---GLCNRCFTRRDLLIRHAQKIH--	80ESCA_DROME	YQC---PDCQKSYSTFSGLTKH-QQFH--
24EVI1_HUMAN	QECK---ECDQVFPDLQSLEKHMLS--H-	20IKZF1_MOUSE	HKCG---YCGRSYKQRSSLEEHKERCH--
25SUHW_DROME	MSCKV---CDRVFYRLDNLRSH-LKQH--	127SRYD_DROME	QECTT---CGKVYNSWYQLQKHISEEH--

Disease	Target DNA Finger 2	Target DNA Finger 1	Helices in Zif268 Backbone	Helices in Zif268 Closely-Related Backbones	Helices in Zif268 Distantly-Related Backbones
Colorblindness	TNN	GNN	5150	3000	1000
Colorblindness	GNN	CNN	3050	3050	3050
Familial Hypercholesterolemia	TNN	ANN	3050	3050	3050
Familial Hypercholesterolemia	TNN	CNN	3050	3050	3050
Pancreatic Cancer	GNN	TNN	5150	3000	1000
Pancreatic Cancer	GNN	ANN	3050	3050	3050

WebLogo for the OPEN data.	WebLogo for the Persikov data.
WebLogo for 10000 sequences generated with our program, when it incorporates only OPEN data.	WebLogo for 10000 sequences generated with our program, when it incorporates both OPEN and Persikov data.
WebLogo for fingers that bind to ANN according to OPEN data.	WebLogo for 10000 sequences generated for an ANN triplet with our program, when it incorporates only OPEN data.	WebLogo for 10000 sequences generated for an ANN triplet with our program, when it incorporates both OPEN and Persikov data.

Target DNA	Cystic Fibrosis	Familial Hypercholesterolemia	Retinal Blastoma	p53	Myc	Pancreatic Cancer
GNN A	Flank 1					?
GNN T	Flank 1
GNN C	?	Flank 2
TNN G		Flank 2			X
TNN C		Flank 3			?
TNN A		Flank 3			?

Round 1 of generating sequences for GAA with the program.	Round 2 of generating sequences for GAA with the program.
GAA sequences from the OPEN dataset.	GAA sequences from Persikov and OPEN datasets.

Index	Nucleotide Sequence (5\'-3\')	Helices (F3 to F1)	Notes
16	GAA GGG AAC	QDGNLGR RREHLVR HRTNLIA	Very similar to one of our target sequences (CB top), which is GAA GGG ACC
55	GGA GTG GTG	QTTHLSR DHSSLKR RNFILQR	Very similar to a target sequence (FH top), which is GGA GTG CTG
77	TGT GAA TAG	RRRNLQI QQTNLTR QPHGLTA	Out of ze air

ID	Conc. (ng/ul)	260/280
1	6.63	1.27
2	12.96	1.53
3	9.28	1.41
4	7.23	1.31
5	12.64	1.55
6	10.77	1.48
7	17.19	1.73
8	39.70	1.78
9	55.73	1.81
10	24.34	1.72
11	25.19	1.68
12	38.57	1.74
13	27.26	1.75

psu = 0	psu = .005	psu = .008
psu = .01	psu = .015.	psu = .020.

'	A	C	D	E	F	G	H	I	K	L	M	N	P	Q	R	S	T	V	W	Y
A	10	0	99	55	0	29	122	20	32	332	2	59	55	63	255	87	24	43	0	0
C	0	0	15	0	0	3	0	0	0	5	0	0	6	0	31	6	14	0	0	0
D	99	15	94	92	0	39	62	6	84	342	15	120	55	42	277	290	87	21	0	8
E	55	0	92	42	0	34	77	1	38	141	2	39	4	29	134	28	90	26	0	1
F	0	0	0	0	0	0	0	10	0	0	0	22	4	0	2	4	6	0	0	0
G	29	3	39	34	0	38	56	0	14	126	1	95	28	47	119	125	38	7	0	0
H	122	0	62	77	0	56	118	9	103	498	4	88	24	26	87	159	70	2	0	0
I	20	0	6	1	10	0	9	6	8	95	3	5	17	3	62	16	17	4	0	0
K	32	0	84	38	0	14	103	8	84	386	24	44	19	102	269	163	113	22	1	0
L	332	5	342	141	0	126	498	95	386	174	32	686	16	112	362	276	875	360	0	8
M	2	0	15	2	0	1	4	3	24	32	0	7	2	11	39	14	3	1	0	0
N	59	0	120	39	22	95	88	5	44	686	7	8	36	28	120	254	84	34	1	0
P	55	6	55	4	4	28	24	17	19	16	2	36	0	3	29	150	21	13	11	0
Q	63	0	42	29	0	47	26	3	102	112	11	28	3	100	261	314	125	19	0	0
R	255	31	277	134	2	119	87	62	269	362	39	120	29	261	618	343	504	281	0	0
S	87	6	290	28	4	125	159	16	163	276	14	254	150	314	343	592	173	91	0	0
T	24	14	87	90	6	38	70	17	113	875	3	84	21	125	504	173	154	28	0	0
V	43	0	21	26	0	7	2	4	22	360	1	34	13	19	281	91	28	12	0	0
W	0	0	0	0	0	0	0	0	1	0	0	1	11	0	0	0	0	0	0	0
Y	0	0	8	1	0	0	0	0	0	8	0	0	0	0	0	0	0	0	0	0

Name	ID	Final?	Notes
FH Top (77)	1	N	1 snp
	2	N	5 snps
	3	Y	G -> C. Still Ala
	4	N	1 snp
FH Bottom (78)	1	N	1 Deletion at 1746, last nucleotide of F of FQRICMRN
CB Top (79)	1	N	A lot of deletions/mistakes in f2/f3 region
CB Bottom (80)	1	Y
	2	Y	G->C. Stiil Ala
	3	N	deletion 1613-1631
	4	N	many mistakes at end, may be ok
Myc 198 (81)	1	Y
	4	Y	G->C. Still Ala.
Myc 981 (82)	1	Y
Pos Con 16 (83)	4	Y	G->C. Still Ala.
	2	N	A lot of deletions/mistakes in f2/f3 region
	3	N	A lot of deletions/mistakes in f2/f3 region
Pos Con 55 (84)	1	Y (?)	Right sequence, but messy trace
	4	N	at 547: deletion at type II binding site at 665: deletion at beginning of F3
Zif 268	1	Y

ID	Is a perfect match with	Notes
Myc 198 (81)	78.2, 78.3
FH Top (77)	81.4, Myc 981	83.4 has 1 deletion
CB Bottom (80)	84.4	78.1 has 5 deletions; Zif has 1 deletion
FH bottom (78)	n/a	84.1 deletion at beginning of F3
CB Top (79)	79.3
Myc 981 (82)	78.4
Zif 268	79.4
Pos Con 55 (83)	79.2	79.3 has deletion at beginning of F3
Pos Con 16	79.1

	FH top (77)	Notes
✓	77.1	Only G -> C in ala
✓	77.3	Only G -> C in ala
	77.4	Single deletion in F3

	FH bottom (78)
	78.1	Many, many SNPs throughout, oddly F and R differ
	78.2	Many, many SNPSs, R starts in a strange place
	78.3	Four deletions throughout on both F and R
	78.4	Many, many SNPs throughout
	Original	Only one SNP in F3, but unacceptable

	CB top (79)
	79.1	Many, many SNPs and deletions throughout, F and R the same
✓	79.2	No SNPs
✓	79.3	No SNPs
	79.4	G -> C in ala, deletion in the Q of the F3 \"FSQ\"

	CB bottom (80)
✓	80.1	No SNPs
	80.2	G -> C in ala, deletion in the homology region shortly after F3 ends
	80.4	G -> C in ala, five deletions in F3/homology region

	Myc 198 (81)
✓	81.1	No SNPs
✓	81.4	Only G -> C in ala

	Myc 981 (82)
✓	82.1	Only G -> C in ala

	Pos con 16 (83)
✓	83.4	Only G -> C in ala

	Pos con 55 (84)
✓	84.1	Only G -> C in ala
	84.4	G -> C in ala, two deletions

	Zif268
✓	Zif268	No SNPs

	OZ052	Notes
✓	1	No snps
✓	2	No snps
✓	3	No snps
	4	Deletion at F1
	OZ123	Notes
✓	1	No snps
	2	deletion in omega linker
✓	3	No snps
✓	4	No snps

	Pos. Con. 77	Notes
	1	lots of snps and deletions
✓	2	G->C
	3	deletion before type II cut site
	4	deletion in terminator
	OZ052 swap	Notes
✓	1	G->C
✓	2	G->C
	3	deletions and mismatches in ultramer
	4	terrible
	OZ123 swap	Notes
✓	1	fine, deletion at end
	2	deletions and snps
	3	long deletion in helix
✓	4	fine
	Zif268 swap	Notes
✓	1	fine, TGEKP instead of TGQKP
✓	2	G->C, TGEKP instead of TGQKP
	3	terrible
✓	4	G->C, TGEKP instead of TGQKP

	GFP Forward	Notes
	1	1 deletion at end
✓	2	perfect
	3	Insert of G
	4	perfect
	GFP Reverse	Notes
	1	4 snps
✓	2	1 deletion at end
	3	0 snps
	4	snps

Oligo	ID	Notes
2	1B	✓
4	3H	✓
5	10A	✓
5	1D	✓
5	1E	lots of snps at beginning
5	3G	✓
6	10C	✓
6	10G	✓
6	3C	✓
6	4A	2 deletions at F1
7	10B	✓
7	10D	✓
7	10E	✓
7	1F	✓
10	3E	✓
12	1C	deletion right before F1
12	1G	2 deletions at end of F1
14	1H	insert 'T' on F1
15	2A	✓
17	10F	✓
17	10H	✓
18	3D	✓
18	3F	✓
18	4B	✓

Team:Harvard/Notebook

From 2011.igem.org

Latest revision as of 23:06, 25 October 2011

June 6th

June 7th

June 8th

June 9th - Wet Lab

June 9th - Bioinformatics

June 10th - Wet Lab

June 10th - Bioinformatics

Visualizations

Properties of amino acids

June 13th - Wet Lab

Gel images

June 13th - Bioinformatics

June 14

Wet Lab

Today's Gel Images

June 14 - Bioinformatics

June 15th - Wet Lab

June 15th - Bioinformatics

June 16th - Wet Lab

June 16 - Bioinformatics

June 17th - Wet Lab

June 17 - Bioinformatics

Goals

Options for Target DNA Sequences / ZF Helices

References

June 20th - Wet Lab

June 20th - Bioinformatics

Goals for the week

Today

Probability data

June 21st

Wet Lab

June 21st - Bioinformatics

Persikov Statistics - Graphs

Phone Call with Dan

Chip Design

Identifying dependencies

June 22nd - Wet Lab

June 22nd - Bioinformatics

Final target sequences

Finalizing the non-Zif268 backbones

Updated Chip Design

Finishing the generator

June 23rd - Wet Lab

June 23rd - Bioinformatics

Revising Target Sequences

June 24

June 24th - Bioinformatics

Playing with Pseudocounts

Updated Closest Zif268 Fingers

Sequence Generation

June 25th-26th - Bioinformatics

June 27

Wet lab

June 27th - Bioinformatics

To Do for Today

100 Control Sequences

Updated Target Sequences

Cut Site Design

Updates on the program

June 28th

June 28th - Bioinformatics

Plasmid and Oligo Design Schematics

Chip-Based Sequence Design Schematic

References

Harvard Logo

Running the Generator!

Generated Final Chip Sequences

Generated WebLogos for Final Chip

Bioinformatics Candids

Design of Plate Practice Sequences

June 29th

PCR Preparation

PCRs

Expression Plasmid Design in silico

June 30th

ZF Expression Plasmid Ultramer and Primer Design

'	A	C	D	E	F	G	H	I	K	L	M	N	P	Q	R	S	T	V	W	Y
A	10	0	99	55	0	29	122	20	32	332	2	59	55	63	255	87	24	43	0	0
C	0	0	15	0	0	3	0	0	0	5	0	0	6	0	31	6	14	0	0	0
D	99	15	94	92	0	39	62	6	84	342	15	120	55	42	277	290	87	21	0	8
E	55	0	92	42	0	34	77	1	38	141	2	39	4	29	134	28	90	26	0	1
F	0	0	0	0	0	0	0	10	0	0	0	22	4	0	2	4	6	0	0	0
G	29	3	39	34	0	38	56	0	14	126	1	95	28	47	119	125	38	7	0	0
H	122	0	62	77	0	56	118	9	103	498	4	88	24	26	87	159	70	2	0	0
I	20	0	6	1	10	0	9	6	8	95	3	5	17	3	62	16	17	4	0	0
K	32	0	84	38	0	14	103	8	84	386	24	44	19	102	269	163	113	22	1	0
L	332	5	342	141	0	126	498	95	386	174	32	686	16	112	362	276	875	360	0	8
M	2	0	15	2	0	1	4	3	24	32	0	7	2	11	39	14	3	1	0	0
N	59	0	120	39	22	95	88	5	44	686	7	8	36	28	120	254	84	34	1	0
P	55	6	55	4	4	28	24	17	19	16	2	36	0	3	29	150	21	13	11	0
Q	63	0	42	29	0	47	26	3	102	112	11	28	3	100	261	314	125	19	0	0
R	255	31	277	134	2	119	87	62	269	362	39	120	29	261	618	343	504	281	0	0
S	87	6	290	28	4	125	159	16	163	276	14	254	150	314	343	592	173	91	0	0
T	24	14	87	90	6	38	70	17	113	875	3	84	21	125	504	173	154	28	0	0
V	43	0	21	26	0	7	2	4	22	360	1	34	13	19	281	91	28	12	0	0
W	0	0	0	0	0	0	0	0	1	0	0	1	11	0	0	0	0	0	0	0
Y	0	0	8	1	0	0	0	0	0	8	0	0	0	0	0	0	0	0	0	0