Team:Edinburgh/RFC

From 2011.igem.org

(Difference between revisions)
(→References)
(Redirected page to Team:Edinburgh/BioSandwich)
 
(17 intermediate revisions not shown)
Line 1: Line 1:
-
{{:Team:Edinburgh/tech/Navbox}}
+
#redirect [[Team:Edinburgh/BioSandwich]]
-
<html><script type="text/javascript" >$(document).ready(function() {
+
-
getMenus('lab','lab_rfc');
+
-
}); </script></html>
+
-
<div class="main_body" style="background: white">
+
-
 
+
-
<p class="h1">BBF RFC xx: "BioSandwich" - a homology based assembly method using a library of standard parts</p>
+
-
 
+
-
Chris French, Allan Crossman<br>
+
-
September, 2011
+
-
 
+
-
==1. Purpose==
+
-
 
+
-
This Request for Comments (RFC) describes a strategy for using homology-based
+
-
assembly methods to assemble parts from a library in any order.
+
-
 
+
-
==2. Relation to other BBF RFCs==
+
-
 
+
-
BBF RFC xx does not update or replace any earlier BBF RFC. It is compatible with most RFC10 parts, with the added requirement that they not contain BglII sites ("agatct").
+
-
 
+
-
==3. Copyright Notice==
+
-
 
+
-
Copyright (C) The BioBricks Foundation (2011). All Rights Reserved.
+
-
 
+
-
==4. Background==
+
-
 
+
-
One of the main aspects of synthetic biology is the assembly of standard
+
-
modular parts from a library to produce larger constructs. There are two main
+
-
types of assembly strategy: hierarchical and homology-based.
+
-
 
+
-
The RFC10 format, which is standard for iGEM projects, is based on
+
-
hierarchical assembly methods such as Standard Assembly and Three Antibiotic
+
-
Assembly. The main advantage of RFC10 is flexibility: any combination of parts
+
-
can be assembled in any order. The main disadvantage is speed.
+
-
 
+
-
Many iGEM teams now use homology-based assembly strategies, such as Gibson
+
-
Assembly. These methods use PCR to create parts that have homologous ends.
+
-
They are then assembled using the method of Gibson ''et al'' (2009). This method
+
-
is relatively fast. However, the order of the parts in the final construct is
+
-
entirely determined by the primers chosen for the initial PCR reactions. If a
+
-
different order is desired, parts have to be remade with new PCR primers.
+
-
 
+
-
BioSandwich is a hybrid that combines many of the benefits of hierarchical
+
-
assembly and homology-based assembly. In particular, it is useful for creating
+
-
different combinations of the same parts in different orders.
+
-
 
+
-
==5. Outline==
+
-
 
+
-
BioSandwich parts are reusable because they come in a standard format (much
+
-
like ordinary BioBricks) with restriction sites flanking the part. The
+
-
restriction sites are BglII (agatct) in the prefix, and SpeI (actagt) in the
+
-
suffix. However, these restriction sites are not used directly for assembly;
+
-
instead they are used to attach short (~35 bp) oligonucleotides (hereafter
+
-
"spacers"). These spacers serve two purposes:
+
-
 
+
-
* They create homology between the end of one part and the start of another; this allows homology-based assembly.
+
-
* They can incorporate short meaningful sequences such as ribosome binding sites, linkers for fusion proteins, etc.
+
-
 
+
-
Any lab using BioSandwich will want to keep a small library of different
+
-
spacers for different purposes. Once (carefully chosen) spacers have been
+
-
attached to each part, homology based assembly can be carried out in a single
+
-
reaction. Precisely which spacers have been attached to which parts will
+
-
determine the order of the parts in the final assembly.
+
-
 
+
-
==6. Formats==
+
-
 
+
-
===6.1. Normal Parts===
+
-
 
+
-
Parts MUST be free of internal BglII restriction sites ("agatct") and SpeI sites
+
-
("actagt"). Each part MUST be made with a BglII site at the start, and a SpeI
+
-
site at the end. For compliance with RFC10, parts SHOULD also be free of
+
-
EcoRI sites ("gaattc"), XbaI sites ("tctaga") and PstI sites ("ctgcag").
+
-
 
+
-
For RFC10 compliance, the the full part format becomes:
+
-
<pre>
+
-
gaattcgcggccgcttctagagatct NNN NNN NNN NNt actagtagcggccgctgcag
+
-
</pre>
+
-
After cutting with BglII and SpeI, we have the following (shown in frame,
+
-
which is relevant for fusion proteins):
+
-
<pre>
+
-
5'    ga tct NNN NNN NNN NNt a        3'
+
-
3'        a nnn nnn nnn nna tga tc    5'
+
-
</pre>
+
-
When a part is used for fusion proteins, the "t" base at the start of the
+
-
RFC10 suffix becomes the final base of the final codon in the part. Design of
+
-
the part SHOULD take this into account. This MAY be done by making this
+
-
final codon "ggt", coding for an innocuous glycine residue. (If a fusion protein
+
-
is not being made, no such consideration is needed. If RFC10-compliance is not
+
-
required, this "t" base MAY be replaced with anything.)
+
-
 
+
-
===6.2. Normal Spacers===
+
-
 
+
-
Spacers are designed as a set of oligonucleotides that can be attached to any
+
-
part via the part's restriction sites. Each type of spacer will be attached
+
-
upstream of one part and downstream of another. Users MUST create
+
-
three different single-stranded oligonucleotides (spacer oligos or "spoligos")
+
-
for each spacer so as to allow annealing and ligation at the restriction
+
-
sites. They SHOULD be designed so that the spacer's non-ligating ends are blunt.
+
-
 
+
-
The format for the upstream spacers is as follows (both strands shown):
+
-
<pre>
+
-
5'    ct agc NNN NNN NNN g        3'              (forward spoligo)
+
-
3'    ga tcg nnn nnn nnn cct ag    5'              (reverse spoligo ONE)
+
-
</pre>
+
-
The format for the downstream spacers is:
+
-
<pre>
+
-
5'    ct agc NNN NNN NNN g        3'              (forward spoligo)
+
-
3'        g nnn nnn nnn c        5'              (reverse spoligo TWO)
+
-
</pre>
+
-
Note that the forward spoligo is used for both upstream and downstream
+
-
attachment.
+
-
 
+
-
The content of different spacers MUST be varied to avoid homology. It is
+
-
RECOMMENDED that non-coding spacers have an in-frame stop codon, in case they
+
-
are to be used after a coding part which lacks one. Non-coding spacers MAY be
+
-
designed to contain useful sequences such as ribosome binding sites.
+
-
 
+
-
===6.3 Vector Part===
+
-
 
+
-
A vector MUST be made as a PCR product with a BglII site ("agatct") at the 5' end and
+
-
an XbaI site ("tctaga") at the 3' end. Since XbaI produces sticky-ends
+
-
compatible with SpeI, the vector is compatible with standard spacers.
+
-
 
+
-
If one wishes the final products (after insertion into the vector) to be
+
-
RFC10-compliant, the format for a vector SHOULD be as follows:
+
-
<pre>
+
-
agatct [nnn] tactagtagcggccgctgcag [ori, cmlR, etc] gaattcgcggccgcttctaga
+
-
</pre>
+
-
Note that a few additional bases MUST also be present at the 5' and 3' ends to
+
-
allow the restriction enzymes space to work. When spacers are to be annealed,
+
-
the vector MUST be cut with BglII and XbaI (not SpeI).
+
-
 
+
-
===6.4. Start Spacer===
+
-
 
+
-
For compliance with RFC10, the spacer that connects the vector to the first
+
-
part SHOULD be in the following format:
+
-
 
+
-
Spoligos attaching upstream of first part:
+
-
<pre>
+
-
5'    ctagag NNNNNNNN g        3'              (forward spoligo)
+
-
3'    gatctc nnnnnnnn cctag    5'              (reverse spoligo ONE)
+
-
</pre>
+
-
Spoligos attaching downstream of vector:
+
-
<pre>
+
-
5'    ctagag NNNNNNNN g        3'              (forward spoligo)
+
-
3'        tc nnnnnnnn c        5'              (reverse spoligo TWO)
+
-
</pre>
+
-
This format ensures that the final product contains a standard RFC10 prefix
+
-
and suffix.
+
-
 
+
-
==7. Assembly==
+
-
 
+
-
===7.1. Digestion of Parts and Vector===
+
-
 
+
-
Each part MUST be digested separately.
+
-
 
+
-
* Parts: digest with BglII and SpeI in NEB Buffer 2
+
-
* Vector: digest with BglII and XbaI in NEB Buffer 2 or 3
+
-
 
+
-
Each tube gets:
+
-
<pre>
+
-
36 uL    Water
+
-
5 uL    DNA
+
-
5 uL    Buffer
+
-
2 uL    Enzyme 1
+
-
2 uL    Enzyme 2
+
-
</pre>
+
-
The digestions SHOULD be left for 2 hours at 37 C. Afterwards they SHOULD be purified
+
-
(e.g. with 5 uL glass beads, and eluted to 10 uL elution buffer).
+
-
 
+
-
===7.2. Ligation of Parts and Vector to Spacers===
+
-
 
+
-
The parts and vector MUST now be ligated to the correct spacers, as follows.
+
-
 
+
-
Each tube gets:
+
-
<pre>
+
-
10 uL    Water
+
-
5 uL    DNA
+
-
1 uL    Spacer pair #1
+
-
1 uL    Spacer pair #2
+
-
2 uL    Ligase buffer
+
-
1 uL    T4 DNA ligase
+
-
</pre>
+
-
Tubes SHOULD then be left for 9 hours at 16 C. They SHOULD then be purified.
+
-
 
+
-
===7.3. Homology-Based Assembly===
+
-
 
+
-
The parts MUST now be assembled using a homology-based assembly method.
+
-
 
+
-
Users MAY choose from a number of different methods, including Gibson
+
-
Assembly, Overlap Extension PCR, Circular Polymerase Extension Cloning,
+
-
and others.
+
-
 
+
-
==8. Authors' contact information==
+
-
 
+
-
Chris French: c.french@ed.ac.uk<br>
+
-
Allan Crossman: igem@nothinginbiology.com
+
-
 
+
-
==References==
+
-
 
+
-
Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO (2009) Enzymatic assembly of DNA molecules up to several hundred kilobases. ''Nature Methods'' '''6''':343-345 (doi: 10.1038/nmeth.1318).
+
-
 
+
-
Quan J, Tian J (2009) Circular Polymerase Extension Cloning of complex gene libraries and pathways. ''PLoS ONE'' '''4'''(7): e6441 (doi: 10.1371/journal.pone.0006441).
+
-
 
+
-
__NOTOC__
+
-
</div> <!-- /main_body-->
+
-
<html></div> <!-- /mids --></html>
+

Latest revision as of 11:45, 17 September 2011

  1. redirect Team:Edinburgh/BioSandwich
Retrieved from "http://2011.igem.org/Team:Edinburgh/RFC"