Team:EPF-Lausanne/Notebook/May2011
From 2011.igem.org
m (moved Team:EPF-Lausanne/Notebook/Week1 to Team:EPF-Lausanne/Notebook/May2011: Making a Monthly notebook, rather than a weekly one.) |
|||
Line 54: | Line 54: | ||
Competant cells (DH5α T1 resistant) were prepared by Henrike, Lilia and Clara using Henrike's protocol, they are stored in a box at -80°C, location indicated on the door of the fridge. | Competant cells (DH5α T1 resistant) were prepared by Henrike, Lilia and Clara using Henrike's protocol, they are stored in a box at -80°C, location indicated on the door of the fridge. | ||
+ | |||
+ | ==Thursday, 26 May 2011== | ||
+ | |||
+ | Competance of the prepared DH5α T1res was measured, 10^5 of CFU/µg . (Henrike, Clara, Lilia). | ||
+ | λ and T4 lysis device plasmids were transformed, but only T4 lysis device transformation gave 3 colonies, nothing for λ samples. | ||
+ | |||
+ | == Friday, 27 May 2011 == | ||
+ | Using Invitrogen PureLink Quick miniprep kit, plasmids containing TetR-GFP, LacI and pSB1A2 plasmids with T4LysisDevice were purified. For TetR-GFP 162ng/µl concentration was obtained and for other samples ~172ng/µl. (Lilia) |
Revision as of 12:33, 27 May 2011
{{{title}}}
Note: this is not week 1. We are just writing here to have it somewhere
Contents |
Wednesday, 11 May 2011
SU8 Training for Lilia, Vincent, and Douglas. We made one complete flow wafer.
Work done, initially on four blank wafers:
- O2 plasma stripped
- SU8 spin-coated + baked. Most wafers had defects (bubbles, or even comets).
- UV exposure of flow pattern
- The best wafer was post-expose baked. The others were left unpolymerised
- Developed in PGMEA. The three non-baked wafers are now stripped and blank again.
- Valid wafer verified by optical microscopy and contact profilometry. Some dust contamination, will need to be blow-cleaned before PDMS moulding.
- The three other wafers can be cleaned and re-used (SRD, Piranha solution, 02 plasma strip).
For details of the process, see protocol for SU8 processes: SU8 Process by CMI
Friday, 13 May 2011
Alina and Douglas designed primers for the sequence verification of the lysis cassette. Four 'forwards' and three 'backwards' primers are needed to sequence the DNA in four segments:
>_1289_F |X|13.05.2011 ttgtcggtgaacgctctcta >_1734_R |X|13.05.2011 cctggctctagtaatttcattcag >_947_F |X|13.05.2011 gcggaatcctgagaaatgct >_440_F |X|13.05.2011 tcctgttgataaaactatggatgaa >_1333_R |X|13.05.2011 cgaaggtgagccagtgtgac >_30_F |X|13.05.2011 agggtctatggcagcaccta >_816_R |X|13.05.2011 caaatgaccgatgccaatag
The primers were designed using the online tool Primer3Plus
Monday, 16 May 2011
Alina and Douglas prepared solutions of LacI and primers for sequencing, ready to send out to microsynth.
Friday, 20 May 2011
Competant cells (DH5α T1 resistant) were prepared by Henrike, Lilia and Clara using Henrike's protocol, they are stored in a box at -80°C, location indicated on the door of the fridge.
Thursday, 26 May 2011
Competance of the prepared DH5α T1res was measured, 10^5 of CFU/µg . (Henrike, Clara, Lilia). λ and T4 lysis device plasmids were transformed, but only T4 lysis device transformation gave 3 colonies, nothing for λ samples.
Friday, 27 May 2011
Using Invitrogen PureLink Quick miniprep kit, plasmids containing TetR-GFP, LacI and pSB1A2 plasmids with T4LysisDevice were purified. For TetR-GFP 162ng/µl concentration was obtained and for other samples ~172ng/µl. (Lilia)