• Introduction
  • Home
  • The Team
  • Photo Gallery
• Our Project
  • Results Summary
  • Selection System
  • In-Vitro Characterization
  • In-Vivo Characterization
  • Microfluidics
  • Data
  • Attributions
• Tools
  • Gibson Assembly
  • MITOMI
• Notebook
  • Protocols
  • May
  • June
  • July
  • August
  • September
  • October
• Considerations
  • Human Practices
  • Safety
• Acknowledgements
  • Sponsors
  • Partners

{{{title}}}

Note: this is not week 1. We are just writing here to have it somewhere

Wednesday, 11 May 2011

SU8 Training for Lilia, Vincent, and Douglas. We made one complete flow wafer.

Work done, initially on four blank wafers:

• O2 plasma stripped
• SU8 spin-coated + baked. Most wafers had defects (bubbles, or even comets).
• UV exposure of flow pattern
• The best wafer was post-expose baked. The others were left unpolymerised
• Developed in PGMEA. The three non-baked wafers are now stripped and blank again.
• Valid wafer verified by optical microscopy and contact profilometry. Some dust contamination, will need to be blow-cleaned before PDMS moulding.
• The three other wafers can be cleaned and re-used (SRD, Piranha solution, 02 plasma strip).

For details of the process, see protocol for SU8 processes: SU8 Process by CMI

Friday, 13 May 2011

Alina and Douglas designed primers for the sequence verification of the lysis cassette. Four 'forwards' and three 'backwards' primers are needed to sequence the DNA in four segments:

>_1289_F     |X|13.05.2011
ttgtcggtgaacgctctcta

>_1734_R     |X|13.05.2011
cctggctctagtaatttcattcag

>_947_F     |X|13.05.2011
gcggaatcctgagaaatgct

>_440_F     |X|13.05.2011
tcctgttgataaaactatggatgaa

>_1333_R     |X|13.05.2011
cgaaggtgagccagtgtgac

>_30_F     |X|13.05.2011
agggtctatggcagcaccta

>_816_R     |X|13.05.2011
caaatgaccgatgccaatag

The primers were designed using the online tool Primer3Plus

Monday, 16 May 2011

Alina and Douglas prepared solutions of LacI and primers for sequencing, ready to send out to microsynth.

Friday, 20 May 2011

Competant cells (DH5α T1 resistant) were prepared by Henrike, Lilia and Clara using Henrike's protocol, they are stored in a box at -80°C, location indicated on the door of the fridge.