"
Team:NTNU Trondheim/Data
From 2011.igem.org
(→rrnB P1 promoter) |
(→rrnB P1 promoter) |
||
| Line 5: | Line 5: | ||
== rrnB P1 promoter == | == rrnB P1 promoter == | ||
| + | |||
| + | [[File: Primer_rrnBL_060711_resultat.JPG|thumb|PCR products from rrnB P1 BioBrick separated on 1.5 % agarose. The marked products represent rrnB P1 with regular pre/sufix]] | ||
The rrnB P1 promoter is negatively regulated by ppGpp [Kilde]. We found the | The rrnB P1 promoter is negatively regulated by ppGpp [Kilde]. We found the | ||
| Line 12: | Line 14: | ||
and is not compatible with the parts in the BBa standard. In order to get the part in BBa standard we | and is not compatible with the parts in the BBa standard. In order to get the part in BBa standard we | ||
PCR amplified the promoter using the BBa_K112118 as template and primers containing the BBa prefix and suffix: | PCR amplified the promoter using the BBa_K112118 as template and primers containing the BBa prefix and suffix: | ||
| + | |||
| + | [[File: Test_rrnB_C3_060811_wiki.jpg|thumb|PCR products from rrnB P1 BioBrick separated on 1.5 % agarose. The marked products represent rrnB P1 with regular pre/sufix]] | ||
| + | |||
{| border="1" | {| border="1" | ||
| Line 31: | Line 36: | ||
The PCR-product was run on a 1,5% agarose gel in order to verify that we had achieved the correct product and to separate it from any other unwanted products. | The PCR-product was run on a 1,5% agarose gel in order to verify that we had achieved the correct product and to separate it from any other unwanted products. | ||
| - | + | ||
The new rrnB P1 biobrick was inserted in the psb1C3 plasmid provided by the iGem HQ. | The new rrnB P1 biobrick was inserted in the psb1C3 plasmid provided by the iGem HQ. | ||
Plasmid from five colonies were digested with the enzymes ....... and .............. giving the lengths ........... and ................ if the promoter was inserted. | Plasmid from five colonies were digested with the enzymes ....... and .............. giving the lengths ........... and ................ if the promoter was inserted. | ||
| - | |||
| - | |||
| - | |||
| + | It seems like parallel 1 and 2 have the insert. | ||
== Stress Sensor == | == Stress Sensor == | ||
Revision as of 12:26, 23 August 2011
Data
rrnB P1 promoter
The rrnB P1 promoter is negatively regulated by ppGpp [Kilde]. We found the promoter in the registry distribution (BBa_K112118) submitted by Berkly in 2008.
This part is in the BBb standard form [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard] and is not compatible with the parts in the BBa standard. In order to get the part in BBa standard we PCR amplified the promoter using the BBa_K112118 as template and primers containing the BBa prefix and suffix:
| Primer | Type | Sequence |
|---|---|---|
| rrnB P1 F | Forward | GTTTCTTCGAATTCGCGGCCGCTTCTAGAGACGTATCCTACGCCCGTGGT |
| rrnB P1 R | Reverse | GTTTCTTCCTGCAGCGGCCGCTACTAGTACGCCTTCCCGCTACAGAGTCA |
The PCR-product was run on a 1,5% agarose gel in order to verify that we had achieved the correct product and to separate it from any other unwanted products.
The new rrnB P1 biobrick was inserted in the psb1C3 plasmid provided by the iGem HQ. Plasmid from five colonies were digested with the enzymes ....... and .............. giving the lengths ........... and ................ if the promoter was inserted.
It seems like parallel 1 and 2 have the insert.
Stress Sensor
