"
Team:Berkeley/BUWsoftware
From 2011.igem.org
The UC Berkeley iGEM volunteered to contribute to the BU-Wellesley's project by providing useful feedback for their project. As a team, the UCB iGEMmers beta-tested the new and improved ClothoCAD dashboard as well as finding bugs and usability issues faced with the new programs like Primer Designer and Trumpet. We hope that our collaboration with BU-Wellesley will make for a more efficient and usable set of software tools for synthetic biology.
1. Dashboard: Resizing the windows
Whenever resizing the window of clotho, the different program icon launchers do not resize accodringly. They became hard to distinguish when minimized too much.
2. Dashboard: Opening Parts/Vectors/Oligos/Plasmids from the left most panel
When double clicking the DNA sequences from the left panel, an icon of the app shows up rather than opening the sequence in the preferred viewer. In order for us to open the sequence, we right click on the sequence and click on preferred viewer (or we choose a viewer from the menu).
3. Sequence View: Recurring Bug
We are still investigating why exactly the following bug keeps on showing up. However, it prevents opening the parts (that show up on the left panel on the dashboard) in sequence view.
java.lang.IndexOutOfBoundsException: Index: 1, Size: 1
at java.util.ArrayList.RangeCheck(ArrayList.java:547)
at java.util.ArrayList.get(ArrayList.java:322)
at org.clothocad.tool.sequenceview.SequenceViewManager.launch(SequenceViewManager.Java:188)
at org. clothocore.api.core.wrapper.ToolWrapper64.run(ToolWrapper.java:120)
[catch] at java.lang.Thread.run(Thread.java:662)
4. Sequence View: Highlighting Features
You can import features from APE and create new features pretty well. However, whenever you click on the features button or select Highlight Features from the menu, the features do not highlight.
5. Spreadit Features: Adding new features
You can type in any letter you want to add a new feature but it does not catch it. If there is anything but a ACTG, it will replace the entire feature with an exclamation point “!”.
6.Sequence View: Finding sequences
It would be useful to be able to add “N”s into the sequencing your viewing.
7.Sequence View: Finding Restriction Sites
The button is non-functional as far as we could tell. We could not find where the enzyme list was nor could we figure out how to add new enzymes and their respective sequences.
8.Sequence View: Type 2S Restriction Enzymes
For our project, we use type 2S restriction enzymes a lot. These enzymes recognize a specific sequence and cut directionally AWAY from the site it recognizes. It is the basis for DNA assembly methods like the Golden Gate. It would be cool to have Clotho accept this format.
9.Sequence View: Digest Button
A feature in APE we use a lot this summer is the digest button. After selecting the enzymes you would like to digest your part with, it gives a ladder GUI with the expected fragment sized.
10. Primer Designer: RE Check
The RE Checker does not work. We tested this by putting RE sites in the sequence to PCRed and also in the spacer. Neither found the RE sites.
11. Primer Designer: Melting Temperature (Tm) Calculator Error
When designing primers, the melting temperature shown calculates it WITH the spacer, when in actuality, the melting temperature of the primer only relies on the region of homology. For example, my primer without a spacer is ATCGCGCTTAGGCAT and its Tm is 51C (according to APE). If i had a 5’ spacer of ACTTT in front, the primer is now ACTTTATCGCGCTTAGGCAT but the relevant melting temperature is still 51C because ACTTT does not anneal to my original sequence. However, Primer Designer calculates the Tm and delta G for the new full sequence along with the spacer which is not helpful.
12. Primer Designer: Suggestion - Rating system on quality of oligo
Along with the delta G, it would be nice to see a rating of the quality of the oligo. This would give a really fast and user friendly way of checking the oligo’s effectiveness. This would probably need some wet lab evidence to back up the rating system but it would be a useful project to undertake.
13. Primer Designer: Loading Files in FASTA/GenBank Format
The program does will in opening the Fasta/GenBank formats, but I can also select another file on accident that does has a random string in the txt file and it will insert that into the text box when its not even a DNA string.
14. Adding new restriction enzymes - something that allows you to pull info from NEB and enter it into feature data base
15. Treating DNA as double stranded - taking into account 5’ and 3’ strands so that simulating assemblies becomes easier
16. Spreadit Features: APE feature import
When importing the APE features into Spreadit, the colors for the features should be saved as well.
17. Overall Usability: Spreadit Features
There should be GUI to easily change the colors of the features because the numbers don’t mean anything to the average user.
18. Overall Usability: Drag and Drop everything
One of the problems with all the programs is that sometimes its very hard to put in a part that you want into the various text boxes. Most of the time, you have to remember the part name or copy it down from the left panel.
19. Overall Usability: Help Features? Mouse-over assistance?
Often times, there are many menu items or database columns that are obscure or not obvious as to what they do. For example, the RG column in the Spreadit Features either has a -1 or 1 in the box next to a feature. Therfore, it would be nice to have some help features that easily link to documentation on the various available features.
20. Useful tools: Gene >> Basic part oligo maker
For our project, we had to PCR out 35 promoters from the E. Coli genome. It took some time as we had to copy out every sequence and add the BglBrick ends to each of them. These 70 primers were made individually. It would be nice to have a genome viewer integrated with an oligo designer such that when you want a selected sequence to be PCRed, the program would create the optimal oligos to make a basic part out of it.
21. Useful Tools: Format Changer (Oligo Maker)
Sometime when receiving parts from the registry during iGEM, we receive them in Bba format. It would be nice to have a program that can design oligos to easily change the parts to Bbb format and visa versa. It would be useful for when we need to convert our Bbb parts back to Bba to submit to the registry. This would also help with other lab that share DNA between each other and use different formats.
22. Inventory manager: Failure to launch
Does not launch in the distribution of Clotho that was given to us.
23. Useful Tools: Inventory Manager
We do not know what the current inventory manager is like; however it would be useful to have basic parts tagged with relevant information - plate #, row/column #, QC sequencing information, person who built it, etc.
24. Collector Browser: Failure to Launch
Launches a picture of a basket. Not sure what this does. We tried copying and pasting information from it but it did not do anything.
25. Registry Importer: Not intuitive
It takes many non-obvious steps to import a part and save it to the local database.
1. Dashboard: Resizing the windows
Whenever resizing the window of clotho, the different program icon launchers do not resize accodringly. They became hard to distinguish when minimized too much.
2. Dashboard: Opening Parts/Vectors/Oligos/Plasmids from the left most panel
When double clicking the DNA sequences from the left panel, an icon of the app shows up rather than opening the sequence in the preferred viewer. In order for us to open the sequence, we right click on the sequence and click on preferred viewer (or we choose a viewer from the menu).
3. Sequence View: Recurring Bug
We are still investigating why exactly the following bug keeps on showing up. However, it prevents opening the parts (that show up on the left panel on the dashboard) in sequence view.
java.lang.IndexOutOfBoundsException: Index: 1, Size: 1
at java.util.ArrayList.RangeCheck(ArrayList.java:547)
at java.util.ArrayList.get(ArrayList.java:322)
at org.clothocad.tool.sequenceview.SequenceViewManager.launch(SequenceViewManager.Java:188)
at org. clothocore.api.core.wrapper.ToolWrapper64.run(ToolWrapper.java:120)
[catch] at java.lang.Thread.run(Thread.java:662)
4. Sequence View: Highlighting Features
You can import features from APE and create new features pretty well. However, whenever you click on the features button or select Highlight Features from the menu, the features do not highlight.
5. Spreadit Features: Adding new features
You can type in any letter you want to add a new feature but it does not catch it. If there is anything but a ACTG, it will replace the entire feature with an exclamation point “!”.
6.Sequence View: Finding sequences
It would be useful to be able to add “N”s into the sequencing your viewing.
7.Sequence View: Finding Restriction Sites
The button is non-functional as far as we could tell. We could not find where the enzyme list was nor could we figure out how to add new enzymes and their respective sequences.
8.Sequence View: Type 2S Restriction Enzymes
For our project, we use type 2S restriction enzymes a lot. These enzymes recognize a specific sequence and cut directionally AWAY from the site it recognizes. It is the basis for DNA assembly methods like the Golden Gate. It would be cool to have Clotho accept this format.
9.Sequence View: Digest Button
A feature in APE we use a lot this summer is the digest button. After selecting the enzymes you would like to digest your part with, it gives a ladder GUI with the expected fragment sized.
10. Primer Designer: RE Check
The RE Checker does not work. We tested this by putting RE sites in the sequence to PCRed and also in the spacer. Neither found the RE sites.
11. Primer Designer: Melting Temperature (Tm) Calculator Error
When designing primers, the melting temperature shown calculates it WITH the spacer, when in actuality, the melting temperature of the primer only relies on the region of homology. For example, my primer without a spacer is ATCGCGCTTAGGCAT and its Tm is 51C (according to APE). If i had a 5’ spacer of ACTTT in front, the primer is now ACTTTATCGCGCTTAGGCAT but the relevant melting temperature is still 51C because ACTTT does not anneal to my original sequence. However, Primer Designer calculates the Tm and delta G for the new full sequence along with the spacer which is not helpful.
12. Primer Designer: Suggestion - Rating system on quality of oligo
Along with the delta G, it would be nice to see a rating of the quality of the oligo. This would give a really fast and user friendly way of checking the oligo’s effectiveness. This would probably need some wet lab evidence to back up the rating system but it would be a useful project to undertake.
13. Primer Designer: Loading Files in FASTA/GenBank Format
The program does will in opening the Fasta/GenBank formats, but I can also select another file on accident that does has a random string in the txt file and it will insert that into the text box when its not even a DNA string.
14. Adding new restriction enzymes - something that allows you to pull info from NEB and enter it into feature data base
15. Treating DNA as double stranded - taking into account 5’ and 3’ strands so that simulating assemblies becomes easier
16. Spreadit Features: APE feature import
When importing the APE features into Spreadit, the colors for the features should be saved as well.
17. Overall Usability: Spreadit Features
There should be GUI to easily change the colors of the features because the numbers don’t mean anything to the average user.
18. Overall Usability: Drag and Drop everything
One of the problems with all the programs is that sometimes its very hard to put in a part that you want into the various text boxes. Most of the time, you have to remember the part name or copy it down from the left panel.
19. Overall Usability: Help Features? Mouse-over assistance?
Often times, there are many menu items or database columns that are obscure or not obvious as to what they do. For example, the RG column in the Spreadit Features either has a -1 or 1 in the box next to a feature. Therfore, it would be nice to have some help features that easily link to documentation on the various available features.
20. Useful tools: Gene >> Basic part oligo maker
For our project, we had to PCR out 35 promoters from the E. Coli genome. It took some time as we had to copy out every sequence and add the BglBrick ends to each of them. These 70 primers were made individually. It would be nice to have a genome viewer integrated with an oligo designer such that when you want a selected sequence to be PCRed, the program would create the optimal oligos to make a basic part out of it.
21. Useful Tools: Format Changer (Oligo Maker)
Sometime when receiving parts from the registry during iGEM, we receive them in Bba format. It would be nice to have a program that can design oligos to easily change the parts to Bbb format and visa versa. It would be useful for when we need to convert our Bbb parts back to Bba to submit to the registry. This would also help with other lab that share DNA between each other and use different formats.
22. Inventory manager: Failure to launch
Does not launch in the distribution of Clotho that was given to us.
23. Useful Tools: Inventory Manager
We do not know what the current inventory manager is like; however it would be useful to have basic parts tagged with relevant information - plate #, row/column #, QC sequencing information, person who built it, etc.
24. Collector Browser: Failure to Launch
Launches a picture of a basket. Not sure what this does. We tried copying and pasting information from it but it did not do anything.
25. Registry Importer: Not intuitive
It takes many non-obvious steps to import a part and save it to the local database.
