Revision as of 01:58, 5 October 2011

HokkaidoU Japan

iGEM 2011 Team of Hokkaido University

Primer Name	Whole Sequence
Primer Name	F/R	Annealing Sequence	Tm	Adding Sequence

EX_F	gcagaattcgcggccgcttctagag
EX_F	Forward	Biobrick Prefix	74.5 C	None
PS_R	agcctgcagcggccgctactagta
PS_R	Reverse	Biobrick Suffix	74.6 C	None
suffix_F	tactagtagcggccgctgcaggct
suffix_F	Forward	Biobrick Suffix	74.6 C	None
prefix_R	ctctagaagcggccgcgaattctgc
prefix_R	Reverse	Biobrick Prefix	74.5 C	None
100up_EX_F	aacctataaaaataccgcatacac
100up_EX_F	Forward	100bp upstream from Biobrick prefix	62.7 C	None
200dn_PS_R	tcccctgattctgtggataaccgt
200dn_PS_R	Reverse	200bp downstream from Biobrick suffix	66.6 C	None

[http://partsregistry.org/wiki/index.php?title=Part:BBa_K496000 See details of 100up_EX_F/200dn_PS_R] (partsregistry)

EX_RBS_SlrP_F	GCAGAATTCGCGGCCGCTTCTAGAaaagaggagaaaatatgtttaatattactaatatacaatctacggc
EX_RBS_SlrP_F	Forward	RBS sequence, 5' terminal of SlrP coding sequence	69.7 C	Biobrick Prefix
PS_SlrP_R	AGCCTGCAGCGGCCGCTACTAGTggtaagtcctaatattttcagacgaag
PS_SlrP_R	Reverse	3'terminal of SlrP coding sequence	64.5 C	Biofusion Suffix
Bsa1_dt_F	GGCGACTAGAGAGACCccaggcatcaaataaaacgaaag
Bsa1_dt_F	Forward	5'terminal of double terminator sequence	63.6 C	BsaI recognition site and its cleavage site
Bsa1_SlrP_R	GGCCTGGCCTGAGACCCCggtaagtcctaatattttcagacga
Bsa1_SlrP_R	Reverse	3'terminal of SlrP coding Sequence	63.0 C	BsaI recognition site and its cleavage site
Bsa1_GSK_SlrP_R	GGCCTGGCCTGAGACCCCACTTTCAGCGAAACTTGTAGTGCGAGGGCGACCACTCATggtaagtcctaatattttcagacga
Bsa1_GSK_SlrP_R	Reverse	3'terminal of SlrP coding Sequence	63.6 C	GSK Tag, BsaI recognition site and its cleavage site

SlrP_373_to_394_F	gaaagtcagtcacctatacccg
SlrP_373_to_394_F	Forward	SlrP coding sequence, from 373bp to 394 bp	63.4 C	None

@@ Line 1: / Line 1: @@
 {{Team:HokkaidoU_Japan/header}}
+[[General Protocols]]
-==Infection assay==
+[[Infection assay]]
-===Preparation of T3SS ''E. coli''===
-===Infection assay using onion cells===
-===Infection assay using HeLa cells===
-===Detection of injected protein using GSK tag===
-'''Protein extraction from infected HeLa cells'''
-'''SDS-PAGE and Western Blot analysis'''
-HeLa cell lysates were subjected to SDS-PAGE, and separated proteins were transferred to an Immobilon-P membranes (Millipore). The membranes were blocked with Blocking buffer (20 mM Tris, 150 mM NaCl, 0.05% Tween 20, 5% nonfat milk) for 1 h at room temperature. The blots were probed with Phospho-GSK-3β (Ser9) antibody (Cell Signaling Technology #9336) or GSK-3β antibody (Cell Signaling Technology #9315) diluted 1/1000 in Blocking buffer and incubated overnight at room temperature. Blots were washed three times with TTBS (20 mM Tris, 150 mM NaCl, 0.05% Tween 20) for 15 min each time. Secondary antibody (alkaline phosphatase-conjugated anti-rabbit immunoglobulin G) was diluted 1/1000 in Blocking buffer and incubated with the blots for 1.5 h at 37C. Blots were washed as described above and developed with BCIP/NBT.