"
Team:HokkaidoU Japan/Protocols/Primers
From 2011.igem.org
(Difference between revisions)
(→Primers Used for Backbone Construction) |
|||
| Line 53: | Line 53: | ||
==Primers Used for Backbone Construction== | ==Primers Used for Backbone Construction== | ||
{|class="primer" style="text-align:center;" | {|class="primer" style="text-align:center;" | ||
| + | |- | ||
| + | !rowspan="2"|Xba_byebye_prefix_F | ||
| + | |colspan="4" style="text-align:left;"| | ||
| + | |||
| + | |||
| + | |||
|- | |- | ||
!rowspan="2"|EX_RBS_SlrP_F | !rowspan="2"|EX_RBS_SlrP_F | ||
| Line 81: | Line 87: | ||
*[https://2011.igem.org/Team:HokkaidoU_Japan/Project/Backbone See details of BsaI Backbone] (Project Page) | *[https://2011.igem.org/Team:HokkaidoU_Japan/Project/Backbone See details of BsaI Backbone] (Project Page) | ||
| - | |||
==Sequencing Primer== | ==Sequencing Primer== | ||
Revision as of 18:28, 5 October 2011
HokkaidoU Japan
iGEM 2011 Team of Hokkaido University
Contents |
Primers
Note
| Primer Name | Whole Sequence | |||
|---|---|---|---|---|
| F/R | Annealing Sequence | Tm | Adding Sequence | |
General Primers
| EX_F | gcagaattcgcggccgcttctagag | |||
|---|---|---|---|---|
| Forward | Biobrick Prefix | 74.5 C | None | |
| PS_R | agcctgcagcggccgctactagta | |||
| Reverse | Biobrick Suffix | 74.6 C | None | |
| suffix_F | tactagtagcggccgctgcaggct | |||
| Forward | Biobrick Suffix | 74.6 C | None | |
| prefix_R | ctctagaagcggccgcgaattctgc | |||
| Reverse | Biobrick Prefix | 74.5 C | None | |
| 100up_EX_F | aacctataaaaataccgcatacac | |||
| Forward | 100bp upstream from Biobrick prefix | 62.7 C | None | |
| 200dn_PS_R | tcccctgattctgtggataaccgt | |||
| Reverse | 200bp downstream from Biobrick suffix | 66.6 C | None | |
- [http://partsregistry.org/wiki/index.php?title=Part:BBa_K496000 See details of 100up_EX_F/200dn_PS_R] (partsregistry)
Primers Used for Backbone Construction
| Xba_byebye_prefix_F |
| |||
|---|---|---|---|---|
| EX_RBS_SlrP_F | GCAGAATTCGCGGCCGCTTCTAGAaaagaggagaaaatatgtttaatattactaatatacaatctacggc | |||
| Forward | RBS sequence, 5' terminal of SlrP coding sequence | 69.7 C | Biobrick Prefix | |
| PS_SlrP_R | AGCCTGCAGCGGCCGCTACTAGTggtaagtcctaatattttcagacgaag | |||
| Reverse | 3'terminal of SlrP coding sequence | 64.5 C | Biofusion Suffix | |
| Bsa1_dt_F | GGCGACTAGAGAGACCccaggcatcaaataaaacgaaag | |||
| Forward | 5'terminal of double terminator sequence | 63.6 C | BsaI recognition site and its cleavage site | |
| Bsa1_SlrP_R | GGCCTGGCCTGAGACCCCggtaagtcctaatattttcagacga | |||
| Reverse | 3'terminal of SlrP coding Sequence | 63.0 C | BsaI recognition site and its cleavage site | |
| Bsa1_GSK_SlrP_R | GGCCTGGCCTGAGACCCCACTTTCAGCGAAACTTGTAGTGCGAGGGCGACCACTCATggtaagtcctaatattttcagacga | |||
| Reverse | 3'terminal of SlrP coding Sequence | 63.6 C | GSK Tag, BsaI recognition site and its cleavage site | |
- See details of BsaI Backbone (Project Page)
Sequencing Primer
| SlrP_373_to_394_F | gaaagtcagtcacctatacccg | |||
|---|---|---|---|---|
| Forward | SlrP coding sequence, from 373bp to 394 bp | 63.4 C | None | |
