Team:USTC-China/Protocol

From 2011.igem.org

(Difference between revisions)
(Toggle Switch-Aptamer-cheZ Device(modified) Construction and Testing)
(Blanked the page)
 
(11 intermediate revisions not shown)
Line 1: Line 1:
-
{{Team:USTC-China/temp}}
 
-
{{Team:USTC-China/temp/bar4}}
 
-
<html><a name="Aptamer-cheZ" id=""></a></html>
 
-
==Aptamer-cheZ Device Construction==
 
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;The cheZ gene was cloned from ''E.coli'' TOP10 strain using PCR. A cassete containing a theophylline-sensitive aptamer, and the cheZ gene was assembled using PCR and was subcloned into the SpeI and PstI sites of pSB1A2 containing the lac promoter.</p>
 
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;Clone Primer:</p>
 
-
<p>Forward:5'-GTTTCGAATTCGCGGCCGCTTCTAGATGCAACCATCAATCAAACC-3'</p>
 
-
<p>Reverse:5'-GTTTCCTGCAGCGGCCGCTACTAGTATTATTAAAATCCAAGTCTATCCAACAAATCGT-3'</p>
 
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;Assemble Primer:</p>
 
-
<p>Forward:5'-GTTTCGAATTCGCGGCCGCTTCTAGGGTGATACCAGCATCGTCTTGATGCCCTTGGCAGCACCCCGCTGCAAGACAACAAG ATGCAACCATCAATCAAACC-3'</p>
 
-
<p>Reverse:5'-GTTTCCTGCAGCGGCCGCTACTAGTATTATTAAAATCCAAGACTATCCAACAAATCGT-3'</p>
 
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;Assemble condition: 96&deg;C 10min, (96&deg;C  30s, 56&deg;C 30s, 72&deg;C 1min)16 cycles and each cycle the annealing temperature increase 1&deg;C, (96&deg;C 30s, 72&deg;C 30s, 72&deg;C 1min)20 cycles,72&deg;C 10min and holding at 4&deg;C.</p>
 
-
<html><a name="Dose-Dependent" id=""></a></html>
 
-
==Dose-Dependent Migration Ability of Aptamer-cheZ Device==
 
-
 
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;To test the migration ability, selective media (tryptone broth with different ratio of agar(0.25%, 0.3%, 0.4%), 50μg/mL ampicllin, and various concentrations of theophylline(0mM, 0.25mM, 0.5mM, 0.5mM, 0.75mM, 1mM)) was prepared in Petri dishes(85mm dia). Diluted cell suspensions from mid-log-phase cultures were applied to the center of the plates, which were dried at room temperature at for 15 min, and incubated at 37&deg;C for 10h, and the migration radii were determined by measuring the diameter of the outermost ring of growth. </p>
 
-
 
-
&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[[File:A().png|400px|center]]<p align=center>(a)</p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;[[File:A(1).png|400px|center]]<p align=center>(b)</p>&nbsp;&nbsp;[[File:A(2).png|400px|center|border]]<p align=center>(c)</p>
 
-
<p align=center>Figure1.((a)0.25%agar, (b)0.3%agar, (c)0.4%agar)</p>
 
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;The results(Figure1) show that the Aptamer-cheZ Device is functional, and the 0.3%agar is the best ratio for the migration experiments.</p>
 
-
<html><a name="Toggle Switch" id=""></a></html>
 
-
==Toggle Switch Device Testing and Modifying==
 
-
 
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;First, test the function of the original Toggle Switch Device from PKU. After the transformation, the ratio between the colonies with red fluorescent and the colonies with green fluorescent is 8:25. </p>
 
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;Then, modify the prototype of the Toggle Switch Device from PKU. The cI gene was subcloned into the SpeI and PstI sites of pSB3t5, a low copy plasmid, containing the LuxPR promoter to create LuxPR-cI Device. After the transformation, prepare the ''E.coli'' RP1616 competence containing the LuxPR-cI Device, then use the original Toggle Switch Device to transform this competence.</p>
 
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;After the transformation, the ratio between the colonies with red fluorescent and the colonies with green fluorescent is 6:1.</p>
 
-
<html><a name="Semi-Solid" id=""></a></html>
 
-
==Semi-Solid Media with the Gadient of Theophylline==
 
-
 
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;Media was prepared in 100mm square Petri dishes. Layers(15ml) of selective 0.3% agar containing theophylline(1mM, 0.25mM, 0mM) were poured in the pattern shown in Figure 2.</p>
 
-
[[File:B().jpg|center|700px]]<br/>[[File:B(1).jpg|center|700px]]<p align=center>Figure2.</p>
 
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;Each layer would solidify for 50 min before applying the following layer. After all layers were applied, the media should equilibrate at room temperature for 3.0 h.</p>
 
-
<html><a name="Toggle" id=""></a></html>
 
-
==Toggle Switch-Aptamer-cheZ Device Construction and Testing==
 
-
 
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;The Aptamer-cheZ Device(without lac promoter) was subcloned into the SpeI and PstI sites of the Toggle Switch Device([http://partsregistry.org/Part:BBa_K228003 BBa_K228003]) from PKU to create the Toggle Switch -Aptamer-cheZ Device. After the transformation, diluted cell suspensions from mid-log-phase cultures were applied to the center of the Semi-Solid Media(as Figure3 shown). The plates were dried the room temperature at for 15 min, and incubated at 37&deg;C for 10h, and the migration radii were determined by measuring the diameter of the outermost ring of growth.</p>
 
-
[[File:D().jpg|center|350px| Figure3.]]
 
-
<p align=center>Figure3.</p>
 
-
<html><a name="Toggle Switch-Aptamer-cheZ" id=""></a></html>
 
-
 
-
==Toggle Switch-Aptamer-cheZ Device(modified) Construction and Testing==
 
-
 
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;Using Toggle Switch-Aptamer-cheZ Device to transform the ''E.coli'' RP1616 competence containing the LuxPR-cI Device. After transformation, diluted cell suspensions from mid-log-phaase cultures were applied to the center of the Semi-Solid Media(as shown in Figure3. ). The plates were dried the room temperature at for 15 min, and incubated at 37&deg℃for 10h, and the migration radii were determined by measuring the diameter of the outermost ring of growth.</p>
 
-
<html><a name="Artificial" id=""></a></html>
 
-
 
-
==Artificial Innate Immunity System Construction and Testing==
 
-
 
-
<p>&nbsp;&nbsp;&nbsp;&nbsp;For the simulation, a cassete containing a ColE7-ImmE7 complex gene([http://partsregistry.org/Part:BBa_K117001 BBa_K117001] ), Toggle Switch-Aptamer-cheZ Device, and Lysis gene([http://partsregistry.org/Part:BBa_K117000 BBa_K117000]) was assembled to create a destruction module. Then using this module to transform the ''E.coli'' RP1616 competence containing the LuxPR-cI Device. After transformation, diluted engineering bacteria and target bacteria  suspensions from mid-log-phaase cultures were applied to the sites(as shown in Figure4. ) of the Semi-Solid Media. The plates were dried the room temperature at for 15 min, and incubated at 37&deg;C for 10h to observe the form change of two colonies.</p>
 
-
[[File:C().jpg|center|350px| Figure4.(Colony1: engineering bacteria, Colony2: target bacteria)]]
 
-
<p align=center>Figure4.(Colony1: engineering bacteria, Colony2: target bacteria)</p>
 

Latest revision as of 18:08, 5 October 2011