06.28-07.01
Design the primers of TPP sensing hammerhead ribozyme(TPP ribozyme) with the strongest RBS and standard restriction enzyme cutting site:
According to the original sequence of four mutations(1.2, 1.20, 2.12, 2.5) of TPP ribozyme, design the primers of the four mutations with the strongest RBS and standard restriction enzyme cutting site.
Transform the given plasmids of mutation 1.2, 1.20, 2.12, 2.5 (with inductive promoter, TPP ribozyme, the part of GFP and terminator) into competence BL21 (DE3) gold. And prepare M63 medium to cultivate the transformed BL21 (DE3) gold.
When bacterial colony is visible, pick each transformed BL21 (DE3) gold and cultivate in LB medium at 37℃.
Do minicrep to get the plasmids of mutation 1.2, 1.20, 2.12, 2.5 (with inductive promoter, TPP ribozyme, the part of GFP and terminator).
Cultivate the transformed BL21 (DE3) gold in M63 medium at 37℃.
Prepare the TPP solution (0.01mM, 0.1mM, 1mM) and prove that the transformed BL21 (DE3) gold can't grow in M63 medium.
07.02-07.05
Dilute the transformed BL21 (DE3) gold in LB medium 1:100 with LB medium to measure its OD and plot the growth curve. Prepare the IPTG solution (0.1M).
Dilute the transformed BL21 (DE3) gold in LB medium 1:100 with LB medium in 96 deep well plates and cultivate until the OD is 0.6 to add different concentration of TPP according to the following chart. After 2h, measure the fluorescence intensity and plot the curve.
μM 1 2 3 4 5 6 7 8 9 10 11 12
A 0 0.2 0.3 1 3 10 0 0.2 0.3 1 3 10
B 0 0.2 0.3 1 3 10 0 0.2 0.3 1 3 10
C 0 0.2 0.3 1 3 10 0 0.2 0.3 1 3 10
D 0 0.2 0.3 1 3 10 0 0.2 0.3 1 3 10
E 0 0.2 0.3 1 3 10 0 0.2 0.3 1 3 10
F 0 0.2 0.3 1 3 10 0 0.2 0.3 1 3 10
G 0 0.2 0.3 1 3 10 0 0.2 0.3 1 3 10
H 0 0.2 0.3 1 3 10 0 0.2 0.3 1 3 10
AD-1-6 cultivate mutation 1.2, AD-7-12 cultivate mutation 1.20, EH-1-6 cultivate mutation 2.12, EH-7-12 cultivate mutation 2.5. All with 1mM IPTG.
Pick each transformed BL21 (DE3) gold and cultivate in M9 medium at 37℃.
Dilute the transformed BL21 (DE3) gold in LB medium 1:100 with LB medium and do the second round of experiment by adding another group of TPP concentrations. After 2h, measure the fluorescence intensity and plot the curve.
The transformed BL21 (DE3) gold can grow in M9 medium.
Dilute the transformed BL21 (DE3) gold in M9 medium 1:100 with M9 medium in 96 deep well plates and cultivate until the OD is 0.6 and then add another group of concentrations of TPP as the following chart. After 2h, measure the fluorescence intensity and plot the curve.
μM 1 2 3 4 5 6 7 8 9 10 11 12
A 0 0.2 1 10 0 0.2 1 10 0 0.2 1 10
B 0 0.2 1 10 0 0.2 1 10 0 0.2 1 10
C 0 0.2 1 10 0 0.2 1 10 0 0.2 1 10
D 0 0.2 1 10
E 0 0.2 1 10
F 0 0.2 10
AC-1-4 cultivate mutation 1.2, AC-5-8 cultivate mutation 1.20, AC-9-12 cultivate mutation 2.12, DF-1-4 cultivate mutation 2.5. All with 1mM IPTG.
Dilute the transformed BL21 (DE3) gold in M9 medium 1:100 with M9 medium to measure its OD and plot the growth curve.
Do another group of concentrations of TPP as follows: 0μM,0.2μM,1μM,10μM,100μM. After 2h, measure the fluorescence intensity and plot the curve.
07.06-07.08
Do other four groups of concentrations of TPP as follows: 0μM,0.01μM,0.05μM,0.1μM,0.2μM, 0.4μM,0.8μM,1μM,5μM,10μM;0μM,0.02μM,0.05μM,0.1μM,0.2μM,0.4μM,0.8μM,1μM,5μM,10μM; 0μM,1×〖10〗^(-11) μM,1×〖10〗^(-10) μM,1×〖10〗^(-9) μM,2×〖10〗^(-9) μM,5×〖10〗^(-9) μM,1×〖10〗^(-8) μM,5×〖10〗^(-8) μM,1×〖10〗^(-7) μM,1×〖10〗^(-6) μM;and 0μM,0.002μM,0.005μM,0.01μM,0.02μM,0.05μM,0.1μM,0.2μM,0.5μM,1μM,2μM formutation 1.2 and 1.20, 0μM,0.001μM,0.002μM,0.005μM,0.01μM,0.02μM,0.05μM,0.1μM,0.5μM,1μM for mutation 2.12 and 2.5. After 2h, measure the fluorescence intensity and plot the curve.
07.09-07.21
pBAD_TPP ribozyme part_GFP_terminator construction:
Use the primers of TPP ribozyme with a strong RBS（AGGAGGT） and standard restriction enzyme cutting site to amplify EX_ TPP ribozyme part_SP, and then enzyme digest with SpeⅠ.
Do PCR to E0840 using the forward primer GTAGGCTCTAGATGCGTAAAGGAGAAGAACTTTTCACTGG and reverse primer AAACTGCAGCGGCCGCTACTAGTA to amplify EX_GFP_terminator_SP, and then enzyme digest with XbaⅠ.
Link the upper two parts using T4 DNA ligase to construct EX_TPP ribozyme part_SX_GFP_terminator_SP. Then enzyme digest with XbaⅠand PstⅠ. PCR to amplify this part.
Do enzyme digestion to pSB1A3 with BBa_I13453 part using SpeⅠand PstⅠ.
Link X_TPP ribozyme part_ SX_GFP_terminator_SP and enzyme digested pSB1A3 with BBa_I13453 part to construct pBAD_TPP ribozyme part_GFP_terminator part.
07.22-08.18
Reconstruct the pBAD_TPP ribozyme part_GFP_terminator parts with Gong Yan：
Digest EX_ TPP ribozyme part_SP with EcoRⅠand SpeⅠand EX_GFP_terminator_SP with XbaⅠand PstⅠ，and then insert these two digested parts into pSB1K3 vector.
Later do PCR to this constructed plasmid with the forward primer GTAGGCAGAATTCGCGGCCGCTTCTAGATCCTCCTTCGGTACATCCAGCTGATGA and reverse primer AAACTGCAGCGGCCGCTACTAGTA to amplify EX_TPP ribozyme part_SX_GFP_terminator_SP, and then enzyme digest with XbaⅠand PstⅠ, then link it with the enzyme digested pSB1A3 with BBa_I13453 part to construct pBAD_TPP ribozyme part_GFP_terminator part.
08.19-08.30
Use the upper same way to construct pBAD_TPP ribozyme part_mcherry_terminator parts with Gong Yan.
08.31-09.14
Mutate the RBS sequence of pBAD_TPP ribozyme part_GFP_terminator parts from AGAGGT to AAGGAGAT, along with the spacing sequence between TPP ribozyme part and GFP part from ACTAG to ATACC.
Insert the first 36bp of Ci-FUSE between spacing sequence and GFP part with the way of site mutation.
09.15-09.30
Change the vector of all accomplished parts into pSB1C3 and sort them.
|
"
